National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10776R-1 
 Symbol wit  Full Name wishful thinking 
 CG No CG10776  Old CG No CG10776 
 Synonyms CG10776, STK-D, ALK3/BMPRII, l(3)64Aa, 1262/15, SE20, l(3)SH12, l(3)S126215, Stk-D, wit, Wit 
 Accession No (Link to NCBI) NM_079953.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCTGTTCCCAATCGCCAGTATAGCTGTATGAGCTACCAGGAGGACGACAACTCATTTCAC 60

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     61  GATGATGATGGCGATCAGGACTCTAGTGGCGAGCTGCAGGAGC-AGCAGGTGGAGTCCAC 120

                           ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| silico     121 TCCGATTCCGAGCGAGCCACATAGACGCACCTGCCCAGATGGC-TACAC-TTTCTGTTTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACCATCTGGAACCAGACGGCCAATGGAGCGCGGGTTGTTAAACAGGGTTGCTGGAAGGAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACACGGATCGCACTTCCATTTGCAGCCAGTCGGAATGTACCAGCTCGGCTCCCACCTCG 300

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     301 AAGACCAGTTCTTTGTACTACTGTTGCTGTTCGGGAGGAGTGTGCAATGCCCAATATTCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGGTCGAACCGGCACCTCTGGAACTGGGCTCCAATGAGGGACGGACTTCGATCACAAAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     421 CGGGCGACAGAAAAACAGCACCAGTCCTTTTTGGCCAGTACAATGCTGGGCCTTGCCGGT 480

10776R-1.IR_full       481 GGACTCACAGCCCTCACAATCGG 503
                           ||||||||||||||||||||||| silico     481 GGACTCACAGCCCTCACAATCGG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_078945.2  CG2346-RA (Fmrf), mRNA 
0   20  NM_164401.3  CG31795-RB, transcript variant B (ia2), mRNA 
0   19  NM_134718.4  CG31795-RA, transcript variant A (ia2), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_078605.1  CG6211-RA (gce), mRNA 
0   NM_169533.1  CG9412-RA, transcript variant A (rin), mRNA 
0   NM_080168.2  CG9412-RB, transcript variant B (rin), mRNA 
0   NM_169531.1  CG9412-RD, transcript variant D (rin), mRNA 
0   NM_169532.1  CG9412-RE, transcript variant E (rin), mRNA 
0   NM_169530.1  CG9412-RC, transcript variant C (rin), mRNA 
0   NM_140984.1  CG5104-RB (CG5104), mRNA 
0   12  NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   12  NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   NM_133133.1  CG7990-RA, transcript variant A (CG7990), mRNA 
0   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_136794.1  CG13231-RA (CG13231), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_140050.2  CG4022-RA (CG4022), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_078637.2  CG9209-RB, transcript variant B (vap), mRNA 
0   15  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_132667.1  CG15756-RA (CG15756), mRNA 
0   10  NM_132131.2  CG14435-RA (CG14435), mRNA 
0   NM_166516.1  CG11170-RB (CG11170), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.