National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10764R-1 
 Symbol CG10764  Full Name CG10764 
 CG No CG10764  Old CG No CG10764 
 Synonyms SP77, gene 2, GENE 2, anon-54Ba, CG10764 
 Accession No (Link to NCBI) NM_137369.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGTTGGTCTCGGTTGCTTTG 
 Primer Seq. 3'
aatctagaggtaccTTTCCGTTCCTATTTCCCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGTTGGTCT CGGTTGCTTT GTTATCTTTG TTAACTTTGT GTGTTACAGA AAATGAACAC 
0061 TTTAAGTTTT TAGAGACTCC TTGTGGGATA TCAACCCGTC CCAAAATTAG CGGTGGTGAC 
0121 GATGCAGCCG AGCCAAATTC TATATGGATG GCAGCGATAT TCAATTCATC CGATTTTCAA 
0181 TGCGGTGGCA CAATTATACA TATGCGTTTT GTGTTAAGTG CTGCTCATTG CTTGGTAAGA 
0241 GGATATGATC TATACGTGAG GTTGGGGGCA CGCAACATAA ATGAGCCCGC TGCTGTCCAC 
0301 ACAGTCATTA ATGTCTTTGT GCACCATGAC TTCATTGCAT CGGAATACCG AAATGATATA 
0361 GGACTGCTTC AACTGTCGGA GAGTATCGTC TACACAGTTC GAGTTCAACC AATTTGCATC 
0421 TTTTTGGATC CGGCTCTCAA AGGGAGTGTT GAAAAATTGA AAACGTTCAG AgNCCTTGGC 
0481 TGGGGAAATA GGAACGGAAA  
 in silico PCR Fragment
0001 TCGTTGGTCT CGGTTGCTTT GTTATCTTTG TTAACTTTGT GTGTTACAGA AAATGAACAC 
0061 TTTAAGTTTT TAGAGACTCC TTGTGGGATA TCAACCCGTC CCAAAATTAG CGGTGGTGAC 
0121 GATGCAGCCG AGCCAAATTC TATATGGATG GCAGCGATAT TCAATTCATC CGATTTTCAA 
0181 TGCGGTGGCA CAATTATACA TATGCGTTTT GTGTTAAGTG CTGCTCATTG CTTGGTAAGA 
0241 GGATATGATC TATACGTGAG GTTGGGGGCA CGCAACATAA ATGAGCCCGC TGCTGTCCAC 
0301 ACAGTCATTA ATGTCTTTGT GCACCATGAC TTCATTGCAT CGGAATACCG AAATGATATA 
0361 GGACTGCTTC AACTGTCGGA GAGTATCGTC TACACAGTTC GAGTTCAACC AATTTGCATC 
0421 TTTTTGGATC CGGCTCTCAA AGGGAGTGTT GAAAAATTGA AAACGTTCAG AGCCCTTGGC 
0481 TGGGGAAATA GGAACGGAAA  
 Assemble Data

10764R-1.IR_full       1   TCGTTGGTCTCGGTTGCTTTGTTATCTTTGTTAACTTTGTGTGTTACAGAAAATGAACAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     1   TCGTTGGTCTCGGTTGCTTTGTTATCTTTGTTAACTTTGTGTGTTACAGAAAATGAACAC 60


10764R-1.IR_full       61  TTTAAGTTTTTAGAGACTCCTTGTGGGATATCAACCCGTCCCAAAATTAGCGGTGGTGAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     61  TTTAAGTTTTTAGAGACTCCTTGTGGGATATCAACCCGTCCCAAAATTAGCGGTGGTGAC 120


10764R-1.IR_full       121 GATGCAGCCGAGCCAAATTCTATATGGATGGCAGCGATATTCAATTCATCCGATTTTCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     121 GATGCAGCCGAGCCAAATTCTATATGGATGGCAGCGATATTCAATTCATCCGATTTTCAA 180


10764R-1.IR_full       181 TGCGGTGGCACAATTATACATATGCGTTTTGTGTTAAGTGCTGCTCATTGCTTGGTAAGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     181 TGCGGTGGCACAATTATACATATGCGTTTTGTGTTAAGTGCTGCTCATTGCTTGGTAAGA 240


10764R-1.IR_full       241 GGATATGATCTATACGTGAGGTTGGGGGCACGCAACATAAATGAGCCCGCTGCTGTCCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     241 GGATATGATCTATACGTGAGGTTGGGGGCACGCAACATAAATGAGCCCGCTGCTGTCCAC 300


10764R-1.IR_full       301 ACAGTCATTAATGTCTTTGTGCACCATGACTTCATTGCATCGGAATACCGAAATGATATA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     301 ACAGTCATTAATGTCTTTGTGCACCATGACTTCATTGCATCGGAATACCGAAATGATATA 360


10764R-1.IR_full       361 GGACTGCTTCAACTGTCGGAGAGTATCGTCTACACAGTTCGAGTTCAACCAATTTGCATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10764R-1.in silico     361 GGACTGCTTCAACTGTCGGAGAGTATCGTCTACACAGTTCGAGTTCAACCAATTTGCATC 420


10764R-1.IR_full       421 TTTTTGGATCCGGCTCTCAAAGGGAGTGTTGAAAAATTGAAAACGTTCAGAGNCCTTGGC 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
10764R-1.in silico     421 TTTTTGGATCCGGCTCTCAAAGGGAGTGTTGAAAAATTGAAAACGTTCAGAGCCCTTGGC 480


10764R-1.IR_full       481 TGGGGAAATAGGAACGGAAA 500
                           ||||||||||||||||||||
10764R-1.in silico     481 TGGGGAAATAGGAACGGAAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  NM_137369.2  CG10764-RA (CG10764), mRNA 
0   NM_057819.3  CG9258-RA (nrv1), mRNA 
0   NM_080182.2  CG9156-RA (Pp1-13C), mRNA 
0   NM_206274.2  CG12605-RC, transcript variant C (CG12605), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   11  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_132163.2  CG2079-RA (Dok), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_079928.1  CG17116-RA (Lip2), mRNA 
0   NM_132059.2  CG4766-RA (CG4766), mRNA 
0   NM_137897.2  CG3831-RA (CG3831), mRNA 
0   NM_138081.1  CG30169-RA (CG30169), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   NM_176538.2  CG33093-RA (CG33093), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_166570.1  CG30187-RA (CG30187), mRNA 
0   NM_135935.2  CG12455-RA, transcript variant A (CG12455), mRNA 
0   NM_165149.1  CG12455-RB, transcript variant B (CG12455), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_132742.1  CG5347-RA (CG5347), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_166211.2  CG30459-RA (CG30459), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_169717.1  CG31279-RA (CG31279), mRNA 
0   NM_164600.2  CG31660-RB, transcript variant B (CG31660), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.