National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10741R-3 
 Symbol CG10741  Full Name CG10741 
 CG No CG10741  Old CG No CG10741 
 Synonyms NEST:bs23g10, CG10741 
 Accession No (Link to NCBI) NM_168555.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Jeibmann A, Halama K, Witte HT, Kim SN, Eikmeier K, Koos B, Klämbt C, Paulus W.
Involvement of CD9 and PDGFR in migration is evolutionarily conserved from Drosophila glia to human glioma.
J. Neurooncol. (2015) 124(3) 373-83 [ PubMed ID = 26224160 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTGCTTACTGGATGCCTTCG 
 Primer Seq. 3'
aatctagaggtaccCTCTGAGTGCAACTGCAACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTTGCTTACT GGATGCCTTC GAGGATTACT ACTACCACAA GGAGATCCAG CGTTTGGTCG 
0061 CCGAAACCGC TGGGGGGGCT ACAGCAACAT CTCCCGCCTC ATNCCGCCTC ATCCGCCTCC 
0121 TCGACGGCCT CCATCTCATC TGCATCCTGC TCGAGTGGAC CCTCNCACTT CCTCCATTGT 
0181 CTCGTCCGCG GCCAGTTCGC ACGGTTCGTT GGCCCAGGTG GCTACTGCCC GAGCGGCCGC 
0241 TGCTCTGGCG GACCAACAAG CACTGGCCAG cCAGAGGGCC ATGTTCTACA ATGTCCAGCA 
0301 TCCTNCAgcN GCTGGAGCAG CTGCATgNGT TGCAGGCGGA GTCCGGCAAT CAGCAGATgC 
0361 ATCCGCNGGC GAACGCCGAT CCTAACGCCT CCTCCATGGC CAACAGTNNG CTCTGGCAGC 
0421 CATGGCGAGA TCTCCAGCAG GcGGCCNCCA TGCATCACCA GCTCTACAGG CAGCAGCAGC 
0481 AGCAGTTGCA GTTGCACTCA GAG 
 in silico PCR Fragment
0001 GTTGCTTACT GGATGCCTTC GAGGATTACT ACTACCACAA GGAGATCCAG CGTTTGGTCG 
0061 CCGAAACCGC TGGGGGGGCT ACAGCAACAT CTCCCGCCTC AT-CCGCCTC ATCCGCCTCC 
0121 TCGACGGCCT CCATCTCATC TGCATCCTGC TCGAGTGGAC CCTC-CACTT CCTCCATTGT 
0181 CTCGTCCGCG GCCAGTTCGC ACGGTTCGTT GGCCCAGGTG GCTACTGCCC GAGCGGCCGC 
0241 TGCTCTGGCG GACCAACAAG CACTGGCCAG CCAGAGGGCC ATGTTCTACA ATGTCCAGCA 
0301 TCCT-CAGCA GCTGGAGCAG CTGCATGCGT TGCAGGCGGA GTCCGGCAAT CAGCAGATGC 
0361 ATCCGCAGGC GAACGCCGAT CCTAACGCCT CCTCCATGGC CAACAGTCTG CTCTGGCAGC 
0421 CATGGCGAGA TCTCCAGCAG GCGGCCGCCA TGCATCACCA GCTCTACAGG CAGCAGCAGC 
0481 AGCAGTTGCA GTTGCACTCA GAG 
 Assemble Data

10741R-3.IR_full        1   TTGCTTACTGGATGCCTTCGAGGATTACTACTACCACAAGGAGATCCAGCGTTTGGTCG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10741R-3.in silico      1   TTGCTTACTGGATGCCTTCGAGGATTACTACTACCACAAGGAGATCCAGCGTTTGGTCG 59


10741R-3.IR_full       61  CCGAAACCGCTGGGGGGGCTACAGCAACATCTCCCGCCTCATNCCGCCTCATCCGCCTCC 119
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
10741R-3.in silico     61  CCGAAACCGCTGGGGGGGCTACAGCAACATCTCCCGCCTCAT-CCGCCTCATCCGCCTCC 119


10741R-3.IR_full       121 TCGACGGCCTCCATCTCATCTGCATCCTGCTCGAGTGGACCCTCNCACTTCCTCCATTGT 179
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10741R-3.in silico     121 TCGACGGCCTCCATCTCATCTGCATCCTGCTCGAGTGGACCCTC-CACTTCCTCCATTGT 179


10741R-3.IR_full       181 CTCGTCCGCGGCCAGTTCGCACGGTTCGTTGGCCCAGGTGGCTACTGCCCGAGCGGCCGC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10741R-3.in silico     181 CTCGTCCGCGGCCAGTTCGCACGGTTCGTTGGCCCAGGTGGCTACTGCCCGAGCGGCCGC 239


10741R-3.IR_full       241 TGCTCTGGCGGACCAACAAGCACTGGCCAGCCAGAGGGCCATGTTCTACAATGTCCAGCA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10741R-3.in silico     241 TGCTCTGGCGGACCAACAAGCACTGGCCAGCCAGAGGGCCATGTTCTACAATGTCCAGCA 299


10741R-3.IR_full       301 TCCTNCAGCNGCTGGAGCAGCTGCATGNGTTGCAGGCGGAGTCCGGCAATCAGCAGATGC 359
                           |||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
10741R-3.in silico     301 TCCT-CAGCAGCTGGAGCAGCTGCATGCGTTGCAGGCGGAGTCCGGCAATCAGCAGATGC 359


10741R-3.IR_full       361 ATCCGCNGGCGAACGCCGATCCTAACGCCTCCTCCATGGCCAACAGTNNGCTCTGGCAGC 419
                           |||||| ||||||||||||||||||||||||||||||||||||||||  |||||||||||
10741R-3.in silico     361 ATCCGCAGGCGAACGCCGATCCTAACGCCTCCTCCATGGCCAACAGTCTGCTCTGGCAGC 419


10741R-3.IR_full       421 CATGGCGAGATCTCCAGCAGGCGGCCNCCATGCATCACCAGCTCTACAGGCAGCAGCAGC 479
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
10741R-3.in silico     421 CATGGCGAGATCTCCAGCAGGCGGCCGCCATGCATCACCAGCTCTACAGGCAGCAGCAGC 479


10741R-3.IR_full       481 AGCAGTTGCAGTTGCACTCAGAG 502
                           |||||||||||||||||||||||
10741R-3.in silico     481 AGCAGTTGCAGTTGCACTCAGAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  20  NM_168555.1  CG10741-RA, transcript variant A (CG10741), mRNA 
0.82   11  46  NM_136191.2  CG31688-RA (CG31688), mRNA 
0.82   11  33  NM_165331.2  CG31687-RA (CG31687), mRNA 
0.82   40  180  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.82   38  156  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.82   26  123  NM_078514.2  CG9653-RA (brk), mRNA 
0.82   23  87  NM_079321.2  CG10571-RA (ara), mRNA 
0.82   11  40  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0.62   18  114  NM_143765.2  CG12218-RA (mei-P26), mRNA 
0.62   41  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0.62   41  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0.41   15  62  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0.41   10  34  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0.41   36  NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0.41   36  NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0.41   36  NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0.41   36  NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0.41   38  108  NM_135954.1  CG13260-RA (CG13260), mRNA 
0.41   41  NM_142140.1  CG17304-RA (CG17304), mRNA 
0.41   59  NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0.41   59  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0.41   30  NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0.2   11  NM_078881.2  CG13968-RA, transcript variant A (sNPF), mRNA 
0.2   11  NM_165316.1  CG13968-RB, transcript variant B (sNPF), mRNA 
0.2   66  NM_176542.1  CG7029-RA (CG7029), mRNA 
0.2   31  NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0.2   31  NM_167031.1  CG10706-RA, transcript variant A (SK), mRNA 
0.2   31  NM_167032.1  CG10706-RB, transcript variant B (SK), mRNA 
0.2   30  NM_206631.1  CG10706-RF, transcript variant F (SK), mRNA 
0.2   30  80  NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.