National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10738R-1 
 Symbol CG10738  Full Name CG10738 
 CG No CG10738  Old CG No CG10738 
 Synonyms GYC, CG10738 
 Accession No (Link to NCBI) NM_168547.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTCCTGCTCCAGCTGGAAACTACCACTCAGGACTGCTGCATCCACTGCTCCTGCTCCTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTTCTGCTCGCTTTTAGCAACTTCCGGCCGACTCATGGAGAGGTCTTCACGCTGGGTTAC 120

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     121 CTCACGGCCTCGCAACGGCGGCCGGG-AAACCTGGACTACAACCGACCCGGTCTCACCAT 180

                           ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATC-CGGCGCCATCTCGCTGGCGGTGGAGGAGGTGAATGCCGGACGACTCAGGGATCGGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTCATTCCCTTCAGTTCGTCGTGGCCGAAACTTACGGTGAGGAGGTGGTCAGCATCCGTC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     301 AAACGGCGGCACTGTGGACGCAGCAGGTGGCCGCCTATATTGGCCCCCAGGA-AACTTGC 360

                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | silico     361 GTACACGAAGGTCGCATGGCGGCCGCCTTTAACCTGCCCATGATATCTTATTACTGCACC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     421 CATCGGGATCCCTCGAACAAGGCTGATTTTCCCACCTTTGCCAGGACACGTCCACCGGAC 480

10738R-1.IR_full       481 ACGCAGATCTCCAAGTCCGTAGT 503
                           ||||||||||||||||||||||| silico     481 ACGCAGATCTCCAAGTCCGTAGT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
100   482  NM_168547.1  CG10738-RA, transcript variant A (CG10738), mRNA 
0   NM_170557.1  CG11525-RD, transcript variant D (CycG), mRNA 
0   NM_170555.1  CG11525-RB, transcript variant B (CycG), mRNA 
0   NM_079870.2  CG11525-RA, transcript variant A (CycG), mRNA 
0   NM_170556.1  CG11525-RC, transcript variant C (CycG), mRNA 
0   NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_079051.2  CG4903-RA (MESR4), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_135892.2  CG4185-RA (NC2beta), mRNA 
0   NM_132734.2  CG9411-RA (CG9411), mRNA 
0   10  NM_139458.2  CG1317-RB (CG1317), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_143811.2  CG5704-RA (CG5704), mRNA 
0   NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 
0   NM_142359.2  CG31256-RA (Brf), mRNA 
0   NM_168904.2  CG5683-RC, transcript variant C (Aef1), mRNA 
0   NM_168903.2  CG5683-RA, transcript variant A (Aef1), mRNA 
0   NM_135717.2  CG6504-RA (Pkd2), mRNA 
0   NM_079296.2  CG8019-RA (hay), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   11  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   10  NM_132288.1  CG15365-RA (CG15365), mRNA 
0   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.