National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10689R-2 
 Symbol l(2)37Cb  Full Name lethal (2) 37Cb 
 CG No CG10689  Old CG No CG10689 
 Synonyms l(2)37Cb, CG10689, Cb, l(2)E104, cg10689 
 Accession No (Link to NCBI) NM_136102.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGAGGAAGAGTCTCGCCTAAAGGACCTGCAGGAGCGCGACGAGTTCGCCAGCCGGCTGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGAAGCGGGATGACGATCGGACGCGCAATGTGGTTGATTCCACCGGCGGACGAAGGGCCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCGAGGAGGCCACCAAGCGACTGAAGCTTGAGCATGAGGATCGGGACAAGATAGTGCCTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACCTGCGTCTGCAGTCGCGTCGCCAGTACCTGGAGAAGCGCAAGGATGACAAGGTGGCCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCTGGAGGCGGACATCCTGGACGATGAGTACCTCTTCGATGAGAGCGTCCTGACCAAAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGAGAAGGAGGAGCGCGAGTACAAGAAGCAACTGCTGAACATCGCCAAGGAGCACGAGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGCGCGGGAACTAGAGCGCATCCAGCGTTATAATATGCCGCAGGACCTGAAAAAGGGAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCGATCTGAATACGTTGAGGTTGATGAGTTTGAGAAGCAACCCAACTCAGAGCAGAAGA 480

10689R-2.IR_full       481 AATGGGAGGCTGAACAGCTG 500
                           |||||||||||||||||||| silico     481 AATGGGAGGCTGAACAGCTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136102.2  CG10689-RA (CG10689), mRNA 
0.2   NM_165214.1  CG5020-RC, transcript variant C (CLIP-190), mRNA 
0.2   NM_176058.1  CG5020-RD, transcript variant D (CLIP-190), mRNA 
0.2   NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0.2   NM_165213.2  CG5020-RB, transcript variant B (CLIP-190), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_142181.2  CG4299-RA (Set), mRNA 
0   NM_205958.1  CG33303-RA (CG33303), mRNA 
0   NM_133087.1  CG6617-RA (CG6617), mRNA 
0   NM_140377.1  CG17687-RA (CG17687), mRNA 
0   NM_138028.1  CG3163-RA (CG3163), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_164562.1  CG3964-RB, transcript variant B (CG3964), mRNA 
0   NM_134966.2  CG3964-RA, transcript variant A (CG3964), mRNA 
0   NM_144414.1  CG18811-RA (CG18811), mRNA 
0   NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   10  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   10  NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_168079.1  CG15013-RC, transcript variant C (dyl), mRNA 
0   NM_139633.2  CG15013-RA, transcript variant A (dyl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.