National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10689R-2 
 Symbol l(2)37Cb  Full Name lethal (2) 37Cb 
 CG No CG10689  Old CG No CG10689 
 Synonyms l(2)37Cb, CG10689, Cb, l(2)E104, cg10689 
 Accession No (Link to NCBI) NM_136102.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGAGGAAGAGTCTCGCCTAA 
 Primer Seq. 3'
aatctagaggtaccCAGCTGTTCAGCCTCCCATTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGAGGAAGA GTCTCGCCTA AAGGACCTGC AGGAGCGCGA CGAGTTCGCC AGCCGGCTGA 
0061 AGAAGCGGGA TGACGATCGG ACGCGCAATG TGGTTGATTC CACCGGCGGA CGAAGGGCCA 
0121 TCGAGGAGGC CACCAAGCGA CTGAAGCTTG AGCATGAGGA TCGGGACAAG ATAGTGCCTC 
0181 ACCTGCGTCT GCAGTCGCGT CGCCAGTACC TGGAGAAGCG CAAGGATGAC AAGGTGGCCG 
0241 AGCTGGAGGC GGACATCCTG GACGATGAGT ACCTCTTCGA TGAGAGCGTC CTGACCAAAC 
0301 GGGAGAAGGA GGAGCGCGAG TACAAGAAGC AACTGCTGAA CATCGCCAAG GAGCACGAGA 
0361 AGGCGCGGGA ACTAGAGCGC ATCCAGCGTT ATAATATGCC GCAGGACCTG AAAAAGGGAG 
0421 AGCGATCTGA ATACGTTGAG GTTGATGAGT TTGAGAAGCA ACCCAACTCA GAGCAGAAGA 
0481 AATGGGAGGC TGAACAGCTG  
 in silico PCR Fragment
0001 GCGAGGAAGA GTCTCGCCTA AAGGACCTGC AGGAGCGCGA CGAGTTCGCC AGCCGGCTGA 
0061 AGAAGCGGGA TGACGATCGG ACGCGCAATG TGGTTGATTC CACCGGCGGA CGAAGGGCCA 
0121 TCGAGGAGGC CACCAAGCGA CTGAAGCTTG AGCATGAGGA TCGGGACAAG ATAGTGCCTC 
0181 ACCTGCGTCT GCAGTCGCGT CGCCAGTACC TGGAGAAGCG CAAGGATGAC AAGGTGGCCG 
0241 AGCTGGAGGC GGACATCCTG GACGATGAGT ACCTCTTCGA TGAGAGCGTC CTGACCAAAC 
0301 GGGAGAAGGA GGAGCGCGAG TACAAGAAGC AACTGCTGAA CATCGCCAAG GAGCACGAGA 
0361 AGGCGCGGGA ACTAGAGCGC ATCCAGCGTT ATAATATGCC GCAGGACCTG AAAAAGGGAG 
0421 AGCGATCTGA ATACGTTGAG GTTGATGAGT TTGAGAAGCA ACCCAACTCA GAGCAGAAGA 
0481 AATGGGAGGC TGAACAGCTG  
 Assemble Data

10689R-2.IR_full       1   GCGAGGAAGAGTCTCGCCTAAAGGACCTGCAGGAGCGCGACGAGTTCGCCAGCCGGCTGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     1   GCGAGGAAGAGTCTCGCCTAAAGGACCTGCAGGAGCGCGACGAGTTCGCCAGCCGGCTGA 60


10689R-2.IR_full       61  AGAAGCGGGATGACGATCGGACGCGCAATGTGGTTGATTCCACCGGCGGACGAAGGGCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     61  AGAAGCGGGATGACGATCGGACGCGCAATGTGGTTGATTCCACCGGCGGACGAAGGGCCA 120


10689R-2.IR_full       121 TCGAGGAGGCCACCAAGCGACTGAAGCTTGAGCATGAGGATCGGGACAAGATAGTGCCTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     121 TCGAGGAGGCCACCAAGCGACTGAAGCTTGAGCATGAGGATCGGGACAAGATAGTGCCTC 180


10689R-2.IR_full       181 ACCTGCGTCTGCAGTCGCGTCGCCAGTACCTGGAGAAGCGCAAGGATGACAAGGTGGCCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     181 ACCTGCGTCTGCAGTCGCGTCGCCAGTACCTGGAGAAGCGCAAGGATGACAAGGTGGCCG 240


10689R-2.IR_full       241 AGCTGGAGGCGGACATCCTGGACGATGAGTACCTCTTCGATGAGAGCGTCCTGACCAAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     241 AGCTGGAGGCGGACATCCTGGACGATGAGTACCTCTTCGATGAGAGCGTCCTGACCAAAC 300


10689R-2.IR_full       301 GGGAGAAGGAGGAGCGCGAGTACAAGAAGCAACTGCTGAACATCGCCAAGGAGCACGAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     301 GGGAGAAGGAGGAGCGCGAGTACAAGAAGCAACTGCTGAACATCGCCAAGGAGCACGAGA 360


10689R-2.IR_full       361 AGGCGCGGGAACTAGAGCGCATCCAGCGTTATAATATGCCGCAGGACCTGAAAAAGGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     361 AGGCGCGGGAACTAGAGCGCATCCAGCGTTATAATATGCCGCAGGACCTGAAAAAGGGAG 420


10689R-2.IR_full       421 AGCGATCTGAATACGTTGAGGTTGATGAGTTTGAGAAGCAACCCAACTCAGAGCAGAAGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10689R-2.in silico     421 AGCGATCTGAATACGTTGAGGTTGATGAGTTTGAGAAGCAACCCAACTCAGAGCAGAAGA 480


10689R-2.IR_full       481 AATGGGAGGCTGAACAGCTG 500
                           ||||||||||||||||||||
10689R-2.in silico     481 AATGGGAGGCTGAACAGCTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136102.2  CG10689-RA (CG10689), mRNA 
0.2   NM_165214.1  CG5020-RC, transcript variant C (CLIP-190), mRNA 
0.2   NM_176058.1  CG5020-RD, transcript variant D (CLIP-190), mRNA 
0.2   NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0.2   NM_165213.2  CG5020-RB, transcript variant B (CLIP-190), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_142181.2  CG4299-RA (Set), mRNA 
0   NM_205958.1  CG33303-RA (CG33303), mRNA 
0   NM_133087.1  CG6617-RA (CG6617), mRNA 
0   NM_140377.1  CG17687-RA (CG17687), mRNA 
0   NM_138028.1  CG3163-RA (CG3163), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_206601.1  CG3019-RB, transcript variant B (su(w[a])), mRNA 
0   NM_057408.3  CG3019-RA, transcript variant A (su(w[a])), mRNA 
0   NM_001042791.1  CG3019-RF, transcript variant F (su(w[a])), mRNA 
0   NM_206600.1  CG3019-RC, transcript variant C (su(w[a])), mRNA 
0   NM_001042792.1  CG3019-RD, transcript variant D (su(w[a])), mRNA 
0   NM_164562.1  CG3964-RB, transcript variant B (CG3964), mRNA 
0   NM_134966.2  CG3964-RA, transcript variant A (CG3964), mRNA 
0   NM_144414.1  CG18811-RA (CG18811), mRNA 
0   NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   10  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   10  NM_141661.1  CG8312-RA, transcript variant A (CG8312), mRNA 
0   NM_176438.1  CG8312-RB, transcript variant B (CG8312), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_168079.1  CG15013-RC, transcript variant C (dyl), mRNA 
0   NM_139633.2  CG15013-RA, transcript variant A (dyl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.