National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10663R-3 
 Symbol CG10663  Full Name CG10663 
 CG No CG10663  Old CG No CG10663 
 Synonyms SP30, CT29868, CG10663 
 Accession No (Link to NCBI) NM_140320.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     1   CAGCACTATCACCACGGATCATCGCATTGGATAGATGGGCGGCGGGTGCACCGTC-TCCG 60

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATGC-CACACCCACAGCGCTGGAGTGGGCGGCGGCGATCGCTCAATCAACACCAGCCCT 120

                           ||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||| silico     121 TCAGTCGCTGGTCCCAGTGGTCACC-ATGCGACGAGG-AGTGC-GTCCGCCGGCGGGAGC 180

                           ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| silico     181 GGTTCTGCAAGGTGA-AGCGCAAGTGCGG-ACACACCAAGCACGTGGAGCAGAGCAAGTG 240

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     241 CAGCCATTGTCATCCTGCACCTGCAATAAAGTGGCAGCCACCGTTAATTCTGGATGATAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCACATCCGCGAGAGAATCCAACCGCTTCCGCAACCCCAACCACAACCACCACCTCCTCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCTCCGTCGATTATTATAAATGCGGCAGCTGCGGCGTCAAGTGGTCCCACTGTGGATTA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCGCTACACCGAATACAAGCCGCCACCAAACTATGCTTCACTTTATCCATCAACACATCC 480

                           |||||||||||||||||||| | |  || silico     481 ACCTATTTATACCCCCACTT-ACCCCGC 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_140320.1  CG10663-RA (CG10663), mRNA 
0.62   10  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0.62   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0.41   10  NM_134667.2  CG11604-RA (CG11604), mRNA 
0.41   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0.2   12  NM_079195.2  CG15002-RB (mas), mRNA 
0   33  59  238  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   43  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   43  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   41  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   41  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   18  NM_130506.1  CG13358-RA (CG13358), mRNA 
0   17  30  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   10  11  NM_132257.1  CG15351-RA (Cp7Fc), mRNA 
0   37  NM_175956.1  CG33003-RA (CG33003), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   NM_139713.2  CG10625-RA, transcript variant A (CG10625), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   NM_168119.1  CG10625-RD, transcript variant D (CG10625), mRNA 
0   40  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   11  19  NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   18  NM_167011.2  CG12179-RA, transcript variant A (CG12179), mRNA 
0   18  NM_131947.2  CG12179-RB, transcript variant B (CG12179), mRNA 
0   18  NM_131946.3  CG12184-RA (CG12184), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   20  22  NM_057511.3  CG3936-RA (N), mRNA 
0   14  22  NM_140154.1  CG12523-RA (CG12523), mRNA 
0   11  25  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.