National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10663R-2 
 Symbol CG10663  Full Name CG10663 
 CG No CG10663  Old CG No CG10663 
 Synonyms SP30, CT29868, CG10663 
 Accession No (Link to NCBI) NM_140320.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCACTATCACCACGGATCA 
 Primer Seq. 3'
aatctagaggtaccGCGGGGTAAGTGGGGGTATAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCACTATC ACCACGGATC ATCGCATTGG ATAGATGGGC GGCGGGTGCA CCGTCTTCCG 
0061 GATGCACACA CCCACAGCGC TGGAGTGGGC GGCGGCGATC GCTCAATCAA CACCAGCCCT 
0121 TCAGTCGCTG GTCCCAGTGG TCACCTATGC GACGAGGAAG TGCTGTCCGC CGGCGGGAGC 
0181 GGTTCTGCAA GGTGAGAGCG CAAGTGCGGC ACACACCAAG CACGTGGAGC AGAGCAAGTG 
0241 CAGCCATTGT CATCCTGCAC CTACAATAAA GTGGCAGCCA CCGTTAATTC TGGATGATAG 
0301 CCACATCCGC GAGAGAATCC AACCGCTTCC GCAACCCCAA CCACAACCAC CACCTCCTCC 
0361 gCCTCCGTCG ATTATTATAA ATGCGGCAGC TGCGGCGTCA AGTGGTCCCA CTGTGGATTA 
0421 TCGCTACACC GAATACAAGC CGCCACCAAA CTATGCTTCA CTTTATCCAT CAACACATCC 
0481 ACCTATTTAT ACCCCCACTT NANCNNGc 
 in silico PCR Fragment
0001 CAGCACTATC ACCACGGATC ATCGCATTGG ATAGATGGGC GGCGGGTGCA CCGTC-TCCG 
0061 GATGC-CACA CCCACAGCGC TGGAGTGGGC GGCGGCGATC GCTCAATCAA CACCAGCCCT 
0121 TCAGTCGCTG GTCCCAGTGG TCACC-ATGC GACGAGG-AG TGC-GTCCGC CGGCGGGAGC 
0181 GGTTCTGCAA GGTGA-AGCG CAAGTGCGG- ACACACCAAG CACGTGGAGC AGAGCAAGTG 
0241 CAGCCATTGT CATCCTGCAC CTGCAATAAA GTGGCAGCCA CCGTTAATTC TGGATGATAG 
0301 CCACATCCGC GAGAGAATCC AACCGCTTCC GCAACCCCAA CCACAACCAC CACCTCCTCC 
0361 GCCTCCGTCG ATTATTATAA ATGCGGCAGC TGCGGCGTCA AGTGGTCCCA CTGTGGATTA 
0421 TCGCTACACC GAATACAAGC CGCCACCAAA CTATGCTTCA CTTTATCCAT CAACACATCC 
0481 ACCTATTTAT ACCCCCACTT -ACCCCGC 
 Assemble Data

10663R-2.IR_full       1   CAGCACTATCACCACGGATCATCGCATTGGATAGATGGGCGGCGGGTGCACCGTCTTCCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10663R-2.in silico     1   CAGCACTATCACCACGGATCATCGCATTGGATAGATGGGCGGCGGGTGCACCGTC-TCCG 60


10663R-2.IR_full       61  GATGCACACACCCACAGCGCTGGAGTGGGCGGCGGCGATCGCTCAATCAACACCAGCCCT 120
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
10663R-2.in silico     61  GATGC-CACACCCACAGCGCTGGAGTGGGCGGCGGCGATCGCTCAATCAACACCAGCCCT 120


10663R-2.IR_full       121 TCAGTCGCTGGTCCCAGTGGTCACCTATGCGACGAGGAAGTGCTGTCCGCCGGCGGGAGC 180
                           ||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||
10663R-2.in silico     121 TCAGTCGCTGGTCCCAGTGGTCACC-ATGCGACGAGG-AGTGC-GTCCGCCGGCGGGAGC 180


10663R-2.IR_full       181 GGTTCTGCAAGGTGAGAGCGCAAGTGCGGCACACACCAAGCACGTGGAGCAGAGCAAGTG 240
                           ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||
10663R-2.in silico     181 GGTTCTGCAAGGTGA-AGCGCAAGTGCGG-ACACACCAAGCACGTGGAGCAGAGCAAGTG 240


10663R-2.IR_full       241 CAGCCATTGTCATCCTGCACCTACAATAAAGTGGCAGCCACCGTTAATTCTGGATGATAG 300
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10663R-2.in silico     241 CAGCCATTGTCATCCTGCACCTGCAATAAAGTGGCAGCCACCGTTAATTCTGGATGATAG 300


10663R-2.IR_full       301 CCACATCCGCGAGAGAATCCAACCGCTTCCGCAACCCCAACCACAACCACCACCTCCTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10663R-2.in silico     301 CCACATCCGCGAGAGAATCCAACCGCTTCCGCAACCCCAACCACAACCACCACCTCCTCC 360


10663R-2.IR_full       361 GCCTCCGTCGATTATTATAAATGCGGCAGCTGCGGCGTCAAGTGGTCCCACTGTGGATTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10663R-2.in silico     361 GCCTCCGTCGATTATTATAAATGCGGCAGCTGCGGCGTCAAGTGGTCCCACTGTGGATTA 420


10663R-2.IR_full       421 TCGCTACACCGAATACAAGCCGCCACCAAACTATGCTTCACTTTATCCATCAACACATCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10663R-2.in silico     421 TCGCTACACCGAATACAAGCCGCCACCAAACTATGCTTCACTTTATCCATCAACACATCC 480


10663R-2.IR_full       481 ACCTATTTATACCCCCACTTNANCNNGC 508
                           |||||||||||||||||||| | |  ||
10663R-2.in silico     481 ACCTATTTATACCCCCACTT-ACCCCGC 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_140320.1  CG10663-RA (CG10663), mRNA 
0.62   10  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0.62   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0.41   10  NM_134667.2  CG11604-RA (CG11604), mRNA 
0.41   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0.2   12  NM_079195.2  CG15002-RB (mas), mRNA 
0   33  59  238  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   43  NM_164566.1  CG3399-RD, transcript variant D (capu), mRNA 
0   43  NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 
0   41  NM_164565.1  CG3399-RC, transcript variant C (capu), mRNA 
0   41  NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   18  NM_130506.1  CG13358-RA (CG13358), mRNA 
0   17  30  NM_135939.2  CG4132-RA (pkaap), mRNA 
0   10  11  NM_132257.1  CG15351-RA (Cp7Fc), mRNA 
0   37  NM_175956.1  CG33003-RA (CG33003), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   NM_139713.2  CG10625-RA, transcript variant A (CG10625), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   NM_168119.1  CG10625-RD, transcript variant D (CG10625), mRNA 
0   40  NM_132976.1  CG5172-RA, transcript variant A (CG5172), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   11  19  NM_165760.2  CG18408-RB, transcript variant B (CAP), mRNA 
0   18  NM_167011.2  CG12179-RA, transcript variant A (CG12179), mRNA 
0   18  NM_131947.2  CG12179-RB, transcript variant B (CG12179), mRNA 
0   18  NM_131946.3  CG12184-RA (CG12184), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   20  22  NM_057511.3  CG3936-RA (N), mRNA 
0   14  22  NM_140154.1  CG12523-RA (CG12523), mRNA 
0   11  25  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.