National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10655R-1 
 Symbol l(2)37Bb  Full Name lethal (2) 37Bb 
 CG No CG10655  Old CG No CG10655 
 Synonyms l(2)35B2, CG10655, Bb, l(2)E58, l(2)37Bb 
 Accession No (Link to NCBI) NM_080530.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet. (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTGCGGTACAGACAAGTG 
 Primer Seq. 3'
aatctagaggtaccAGGAAGTCTGCGGCAAATAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTTGCGGT ACAGACAAGT GGTGGGTCTC CTTCAGCGCC GTAATTTCTC GGCCGGAGCA 
0061 ACGAGCAATG GAAGTGGATC TTCCGGGGGC GACAAATCCG GCGAAGACCT GCACCCCATA 
0121 CGACGAACAC TCCGTTTGCT CGGGAACGAT ATGCGCAAAG TTAAGGAGTT CTTTGTACCA 
0181 AAGGAACCGG AGACCGAGAA AGTTCCCATT CCGACACAGA GCCAGTTTCA CTTTTCAGGG 
0241 GAGCGCGACA AGAGCAAGGA AGCCACTGTG CCGGATGACT TCCAGACCCA TTGCGATGTG 
0301 CTCATCATTG GCGGCGGTGG AGTGGGCAGC TCCATCGCCT ATTGGCTGAA GGAGAAGGCC 
0361 CGCGACGGTC TTAACGTTGT GGTGGTCGAG AAGGATGACA CGTATGCCCA GTCAGCCACG 
0421 CGTGTTTCGG TGGGCGGTCT TTGTCAGCAA TTCTCCCTGC CCGAAAACAT CCAAATGTCA 
0481 CTATTTGCCG CAGACTTCCT  
 in silico PCR Fragment
0001 ATGTTGCGGT ACAGACAAGT GGTGGGTCTC CTTCAGCGCC GTAATTTCTC GGCCGGAGCA 
0061 ACGAGCAATG GAAGTGGATC TTCCGGGGGC GACAAATCCG GCGAAGACCT GCACCCCATA 
0121 CGACGAACAC TCCGTTTGCT CGGGAACGAT ATGCGCAAAG TTAAGGAGTT CTTTGTACCA 
0181 AAGGAACCGG AGACCGAGAA AGTTCCCATT CCGACACAGA GCCAGTTTCA CTTTTCAGGG 
0241 GAGCGCGACA AGAGCAAGGA AGCCACTGTG CCGGATGACT TCCAGACCCA TTGCGATGTG 
0301 CTCATCATTG GCGGCGGTGG AGTGGGCAGC TCCATCGCCT ATTGGCTGAA GGAGAAGGCC 
0361 CGCGACGGTC TTAACGTTGT GGTGGTCGAG AAGGATGACA CGTATGCCCA GTCAGCCACG 
0421 CGTGTTTCGG TGGGCGGTCT TTGTCAGCAA TTCTCCCTGC CCGAAAACAT CCAAATGTCA 
0481 CTATTTGCCG CAGACTTCCT  
 Assemble Data

10655R-1.IR_full       1   ATGTTGCGGTACAGACAAGTGGTGGGTCTCCTTCAGCGCCGTAATTTCTCGGCCGGAGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     1   ATGTTGCGGTACAGACAAGTGGTGGGTCTCCTTCAGCGCCGTAATTTCTCGGCCGGAGCA 60


10655R-1.IR_full       61  ACGAGCAATGGAAGTGGATCTTCCGGGGGCGACAAATCCGGCGAAGACCTGCACCCCATA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     61  ACGAGCAATGGAAGTGGATCTTCCGGGGGCGACAAATCCGGCGAAGACCTGCACCCCATA 120


10655R-1.IR_full       121 CGACGAACACTCCGTTTGCTCGGGAACGATATGCGCAAAGTTAAGGAGTTCTTTGTACCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     121 CGACGAACACTCCGTTTGCTCGGGAACGATATGCGCAAAGTTAAGGAGTTCTTTGTACCA 180


10655R-1.IR_full       181 AAGGAACCGGAGACCGAGAAAGTTCCCATTCCGACACAGAGCCAGTTTCACTTTTCAGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     181 AAGGAACCGGAGACCGAGAAAGTTCCCATTCCGACACAGAGCCAGTTTCACTTTTCAGGG 240


10655R-1.IR_full       241 GAGCGCGACAAGAGCAAGGAAGCCACTGTGCCGGATGACTTCCAGACCCATTGCGATGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     241 GAGCGCGACAAGAGCAAGGAAGCCACTGTGCCGGATGACTTCCAGACCCATTGCGATGTG 300


10655R-1.IR_full       301 CTCATCATTGGCGGCGGTGGAGTGGGCAGCTCCATCGCCTATTGGCTGAAGGAGAAGGCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     301 CTCATCATTGGCGGCGGTGGAGTGGGCAGCTCCATCGCCTATTGGCTGAAGGAGAAGGCC 360


10655R-1.IR_full       361 CGCGACGGTCTTAACGTTGTGGTGGTCGAGAAGGATGACACGTATGCCCAGTCAGCCACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     361 CGCGACGGTCTTAACGTTGTGGTGGTCGAGAAGGATGACACGTATGCCCAGTCAGCCACG 420


10655R-1.IR_full       421 CGTGTTTCGGTGGGCGGTCTTTGTCAGCAATTCTCCCTGCCCGAAAACATCCAAATGTCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10655R-1.in silico     421 CGTGTTTCGGTGGGCGGTCTTTGTCAGCAATTCTCCCTGCCCGAAAACATCCAAATGTCA 480


10655R-1.IR_full       481 CTATTTGCCGCAGACTTCCT 500
                           ||||||||||||||||||||
10655R-1.in silico     481 CTATTTGCCGCAGACTTCCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080530.2  CG10655-RA (l(2)37Bb), mRNA 
0.82   NM_167189.2  CG32705-RA (CG32705), mRNA 
0.2   NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0.2   NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0.2   NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   NM_144306.2  CG13130-RA (CG13130), mRNA 
0   NM_169966.1  CG31198-RA (CG31198), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_135243.1  CG13775-RA (CG13775), mRNA 
0   NM_142589.1  CG4468-RA (CG4468), mRNA 
0   10  NM_136451.1  CG2137-RA (CG2137), mRNA 
0   NM_057249.4  CG7793-RA (Sos), mRNA 
0   15  NM_167852.1  CG9097-RB, transcript variant B (bab1), mRNA 
0   NM_206229.1  CG9097-RA, transcript variant A (bab1), mRNA 
0   NM_137116.2  CG8422-RA (CG8422), mRNA 
0   NM_169704.1  CG32855-RA (CG32855), mRNA 
0   NM_143784.2  CG17645-RA (Pglym87), mRNA 
0   NM_169359.1  CG14685-RC, transcript variant C (Cap-H2), mRNA 
0   NM_169358.1  CG14685-RA, transcript variant A (Cap-H2), mRNA 
0   NM_141757.1  CG14685-RB, transcript variant B (Cap-H2), mRNA 
0   NM_001031896.1  CG33651-RA (CG33651), mRNA 
0   NM_001042820.1  CG34145-RA (CG34145), mRNA 
0   NM_130535.2  CG11380-RA (CG11380), mRNA 
0   NM_057920.3  CG3423-RA (SA), mRNA 
0   NM_057785.3  CG5373-RA (Pi3K59F), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_057956.2  CG10269-RA (D19A), mRNA 
0   NM_137421.2  CG6370-RA (CG6370), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.