National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10642R-2 
 Symbol Klp64D  Full Name Kinesin-like protein at 64D 
 CG No CG10642  Old CG No CG10642 
 Synonyms Kif3A, klp64D, KIF3A, CG10642, DmKlp64D, KLP64D, KLP4, Klp4, Klp64D 
 Accession No (Link to NCBI) NM_079210.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Vuong LT, Mukhopadhyay B, Choi KW.
Kinesin-II recruits Armadillo and Dishevelled for Wingless signaling in Drosophila.
Development (2014) 141(16) 3222-32 [ PubMed ID = 25063455 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCGCAGGAGGAGGCAAAT 
 Primer Seq. 3'
aatctagaggtaccAGATCCCGCACCTCTTCGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCCGCAGG AGGAGGCAAA TGCGGGAACA ACGGCCCAAC TCGATGACGA AATCGAGAAT 
0061 GTGCGTGTGG TGGTGCGAAC GCGACCCATG GACAAAAATG AGTTGTCCGC GGGAGCGCTA 
0121 AGTGCGATTT CGGTGGATAA GATCAACCGG GCCATTACGG TGATGAAACC GAATGCCACC 
0181 GCCAATGAAC CGCCGAAAAC GTACTACTTC GACAATGTAT TCGATGGTGG CTCCAATCAA 
0241 ATGGATCTCT ATGTGGACAC CGCTCGTCCG ATTGTGGACA AGGTGCTGGA GGGCTATAAT 
0301 GGCACCATCT TGGCCTACGG ACAAACGGGC ACCGGCAAGA CGTATACCAT GTCGGGGAAT 
0361 CCGGATTCGC CGCAAACAAA GGGCATCATT CCGAATGCAT TTGCGCACAT CTTTGGTCAC 
0421 ATTGCTAAGG CCAAGGAGAA TCAGAAGTTC CTGGTGCGCG TCAGCTACAT GGAGATCTAT 
0481 AACGAAGAGG TGCGGGATCT  
 in silico PCR Fragment
0001 ATGCCGCAGG AGGAGGCAAA TGCGGGAACA ACGGCCCAAC TCGATGACGA AATCGAGAAT 
0061 GTGCGTGTGG TGGTGCGAAC GCGACCCATG GACAAAAATG AGTTGTCCGC GGGAGCGCTA 
0121 AGTGCGATTT CGGTGGATAA GATCAACCGG GCCATTACGG TGATGAAACC GAATGCCACC 
0181 GCCAATGAAC CGCCGAAAAC GTACTACTTC GACAATGTAT TCGATGGTGG CTCCAATCAA 
0241 ATGGATCTCT ATGTGGACAC CGCTCGTCCG ATTGTGGACA AGGTGCTGGA GGGCTATAAT 
0301 GGCACCATCT TGGCCTACGG ACAAACGGGC ACCGGCAAGA CGTATACCAT GTCGGGGAAT 
0361 CCGGATTCGC CGCAAACAAA GGGCATCATT CCGAATGCAT TTGCGCACAT CTTTGGTCAC 
0421 ATTGCTAAGG CCAAGGAGAA TCAGAAGTTC CTGGTGCGCG TCAGCTACAT GGAGATCTAT 
0481 AACGAAGAGG TGCGGGATCT  
 Assemble Data

10642R-2.IR_full       1   ATGCCGCAGGAGGAGGCAAATGCGGGAACAACGGCCCAACTCGATGACGAAATCGAGAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     1   ATGCCGCAGGAGGAGGCAAATGCGGGAACAACGGCCCAACTCGATGACGAAATCGAGAAT 60


10642R-2.IR_full       61  GTGCGTGTGGTGGTGCGAACGCGACCCATGGACAAAAATGAGTTGTCCGCGGGAGCGCTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     61  GTGCGTGTGGTGGTGCGAACGCGACCCATGGACAAAAATGAGTTGTCCGCGGGAGCGCTA 120


10642R-2.IR_full       121 AGTGCGATTTCGGTGGATAAGATCAACCGGGCCATTACGGTGATGAAACCGAATGCCACC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     121 AGTGCGATTTCGGTGGATAAGATCAACCGGGCCATTACGGTGATGAAACCGAATGCCACC 180


10642R-2.IR_full       181 GCCAATGAACCGCCGAAAACGTACTACTTCGACAATGTATTCGATGGTGGCTCCAATCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     181 GCCAATGAACCGCCGAAAACGTACTACTTCGACAATGTATTCGATGGTGGCTCCAATCAA 240


10642R-2.IR_full       241 ATGGATCTCTATGTGGACACCGCTCGTCCGATTGTGGACAAGGTGCTGGAGGGCTATAAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     241 ATGGATCTCTATGTGGACACCGCTCGTCCGATTGTGGACAAGGTGCTGGAGGGCTATAAT 300


10642R-2.IR_full       301 GGCACCATCTTGGCCTACGGACAAACGGGCACCGGCAAGACGTATACCATGTCGGGGAAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     301 GGCACCATCTTGGCCTACGGACAAACGGGCACCGGCAAGACGTATACCATGTCGGGGAAT 360


10642R-2.IR_full       361 CCGGATTCGCCGCAAACAAAGGGCATCATTCCGAATGCATTTGCGCACATCTTTGGTCAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     361 CCGGATTCGCCGCAAACAAAGGGCATCATTCCGAATGCATTTGCGCACATCTTTGGTCAC 420


10642R-2.IR_full       421 ATTGCTAAGGCCAAGGAGAATCAGAAGTTCCTGGTGCGCGTCAGCTACATGGAGATCTAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10642R-2.in silico     421 ATTGCTAAGGCCAAGGAGAATCAGAAGTTCCTGGTGCGCGTCAGCTACATGGAGATCTAT 480


10642R-2.IR_full       481 AACGAAGAGGTGCGGGATCT 500
                           ||||||||||||||||||||
10642R-2.in silico     481 AACGAAGAGGTGCGGGATCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079210.1  CG10642-RA (Klp64D), mRNA 
0.62   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0.62   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_079305.2  CG7293-RA (Klp68D), mRNA 
0   NM_141195.2  CG9791-RA, transcript variant A (CG9791), mRNA 
0   NM_142803.1  CG5326-RA, transcript variant A (CG5326), mRNA 
0   NM_143014.2  CG13624-RC, transcript variant C (CG13624), mRNA 
0   NM_001043288.1  CG13624-RF, transcript variant F (CG13624), mRNA 
0   NM_170150.1  CG13624-RA, transcript variant A (CG13624), mRNA 
0   NM_001043287.1  CG13624-RE, transcript variant E (CG13624), mRNA 
0   NM_170151.1  CG13624-RB, transcript variant B (CG13624), mRNA 
0   NM_170152.1  CG13624-RD, transcript variant D (CG13624), mRNA 
0   16  NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   NM_139532.1  CG14967-RA (CG14967), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
0   NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 
0   NM_142971.2  CG5524-RA (CG5524), mRNA 
0   NM_169834.1  CG7720-RA, transcript variant A (CG7720), mRNA 
0   NM_142496.2  CG7720-RB, transcript variant B (CG7720), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   19  NM_080254.2  CG6392-RA (cmet), mRNA 
0   19  NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   19  NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   11  NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   10  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_140879.1  CG9392-RA (CG9392), mRNA 
0   NM_057550.3  CG10118-RB, transcript variant B (ple), mRNA 
0   NM_057549.2  CG10118-RA, transcript variant A (ple), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.