National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10642R-1 
 Symbol Klp64D  Full Name Kinesin-like protein at 64D 
 CG No CG10642  Old CG No CG10642 
 Synonyms Kif3A, klp64D, KIF3A, CG10642, DmKlp64D, KLP64D, KLP4, Klp4, Klp64D 
 Accession No (Link to NCBI) NM_079210.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
Kim JY, Tsogtbaatar O, Cho KO.
Dynein Heavy Chain 64C Differentially Regulates Cell Survival and Proliferation of Wingless-Producing Cells in Drosophila melanogaster.
J Dev Biol (2021) 9(4) [ PubMed ID = 34698231 ] [ RRC reference ]

Vuong LT, Won JH, Nguyen MB, Choi KW.
Role of Armadillo repeat 2 and kinesin-II motor subunit Klp64D for wingless signaling in Drosophila.
Sci Rep (2020) 10(1) 13864 [ PubMed ID = 32807823 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Vuong LT, Mukhopadhyay B, Choi KW.
Kinesin-II recruits Armadillo and Dishevelled for Wingless signaling in Drosophila.
Development (2014) 141(16) 3222-32 [ PubMed ID = 25063455 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCCGCAGGAGGAGGCAAATGCGGGAACAACGGCCCAACTCGATGACGAAATCGAGAAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGCGTGTGGTGGTGCGAACGCGACCCATGGACAAAAATGAGTTGTCCGCGGGAGCGCTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGTGCGATTTCGGTGGATAAGATCAACCGGGCCATTACGGTGATGAAACCGAATGCCACC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCAATGAACCGCCGAAAACGTACTACTTCGACAATGTATTCGATGGTGGCTCCAATCAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATGGATCTCTATGTGGACACCGCTCGTCCGATTGTGGACAAGGTGCTGGAGGGCTATAAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCACCATCTTGGCCTACGGACAAACGGGCACCGGCAAGACGTATACCATGTCGGGGAAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGGATTCGCCGCAAACAAAGGGCATCATTCCGAATGCATTTGCGCACATCTTTGGTCAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTGCTAAGGCCAAGGAGAATCAGAAGTTCCTGGTGCGCGTCAGCTACATGGAGATCTAT 480

10642R-1.IR_full       481 AACGAAGAGGTGCGGGATCT 500
                           |||||||||||||||||||| silico     481 AACGAAGAGGTGCGGGATCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079210.1  CG10642-RA (Klp64D), mRNA 
0.62   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0.62   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_079305.2  CG7293-RA (Klp68D), mRNA 
0   NM_141195.2  CG9791-RA, transcript variant A (CG9791), mRNA 
0   NM_142803.1  CG5326-RA, transcript variant A (CG5326), mRNA 
0   NM_143014.2  CG13624-RC, transcript variant C (CG13624), mRNA 
0   NM_001043288.1  CG13624-RF, transcript variant F (CG13624), mRNA 
0   NM_170150.1  CG13624-RA, transcript variant A (CG13624), mRNA 
0   NM_001043287.1  CG13624-RE, transcript variant E (CG13624), mRNA 
0   NM_170151.1  CG13624-RB, transcript variant B (CG13624), mRNA 
0   NM_170152.1  CG13624-RD, transcript variant D (CG13624), mRNA 
0   16  NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   NM_139532.1  CG14967-RA (CG14967), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
0   NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 
0   NM_142971.2  CG5524-RA (CG5524), mRNA 
0   NM_169834.1  CG7720-RA, transcript variant A (CG7720), mRNA 
0   NM_142496.2  CG7720-RB, transcript variant B (CG7720), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   19  NM_080254.2  CG6392-RA (cmet), mRNA 
0   19  NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   19  NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   11  NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   10  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_140879.1  CG9392-RA (CG9392), mRNA 
0   NM_057550.3  CG10118-RB, transcript variant B (ple), mRNA 
0   NM_057549.2  CG10118-RA, transcript variant A (ple), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.