National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1063R-1 
 Symbol Itp-r83A  Full Name Inositol 1,4,5,-tris-phosphate receptor 
 CG No CG1063  Old CG No CG1063 
 Synonyms itpr, IP3R, IP[[3]]R, DmInsP[[3]]R, DmInsP[[3R]], InsP[[3]]R, dip, IP[[3]] receptor, CG1063, Itp-r[1], InsP[[3]], unnamed, l(3)05616, DIP, l(3)j5B4, Itp-r42B, Itp-r, Insp3R, IP, anon-WO02059370.49, Itp-r83A 
 Accession No (Link to NCBI) NM_169061.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Chakraborty S, Hasan G.
Spontaneous Ca(2+) Influx in Drosophila Pupal Neurons Is Modulated by IP3-Receptor Function and Influences Maturation of the Flight Circuit.
Front Mol Neurosci (2017) 10 111 [ PubMed ID = 28473752 ] [ RRC reference ]

Chakraborty S, Deb BK, Chorna T, Konieczny V, Taylor CW, Hasan G.
Mutant IP3 receptors attenuate store-operated Ca2+ entry by destabilizing STIM-Orai interactions in Drosophila neurons.
J Cell Sci. (2016) [ PubMed ID = 27591258 ] [ RRC reference ]

Murmu MS, Martin JR.
Interaction between cAMP and intracellular Ca(2+)-signaling pathways during odor-perception and adaptation in Drosophila.
Biochim. Biophys. Acta (2016) 1863(9) 2156-74 [ PubMed ID = 27212269 ] [ RRC reference ]

Restrepo S, Basler K.
Drosophila wing imaginal discs respond to mechanical injury via slow InsP3R-mediated intercellular calcium waves.
Nat Commun (2016) 7 12450 [ PubMed ID = 27503836 ] [ RRC reference ]

Deb BK, Pathak T, Hasan G.
Store-independent modulation of Ca(2+) entry through Orai by Septin 7.
Nat Commun (2016) 7 [ PubMed ID = 27225060 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Sadaf S, Birman S, Hasan G.
Synaptic activity in serotonergic neurons is required for air-puff stimulated flight in Drosophila melanogaster.
PLoS ONE (2012) 7(9) e46405 [ PubMed ID = 23029511 ] [ RRC reference ]

Murmu MS, Stinnakre J, RĂ©al E, Martin JR.
Calcium-stores mediate adaptation in axon terminals of olfactory receptor neurons in Drosophila.
BMC Neurosci (2011) 12 105 [ PubMed ID = 22024464 ] [ RRC reference ]

Murmu MS, Stinnakre J, Martin JR.
Presynaptic Ca2+ stores contribute to odor-induced responses in Drosophila olfactory receptor neurons.
J Exp Biol. (2010) 213(Pt 24) 4163-73 [ PubMed ID = 21112997 ] [ RRC reference ]

Kain P, Badsha F, Hussain SM, Nair A, Hasan G, Rodrigues V.
Mutants in phospholipid signaling attenuate the behavioral response of adult Drosophila to trehalose.
Chem. Senses (2010) 35(8) 663-73 [ PubMed ID = 20543015 ] [ RRC reference ]

Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Usui-Aoki K, Matsumoto K, Koganezawa M, Kohatsu S, Isono K, Matsubayashi H, Yamamoto MT, Ueda R, Takahashi K, Saigo K, Mikoshiba K, Yamamoto D.
Targeted expression of Ip3 sponge and Ip3 dsRNA impaires sugar taste sensation in Drosophila.
J Neurogenet. (2005) 19(3-4) 123-41 [ PubMed ID = 16540404 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     1   CAAGCTTCCTGCACTTGGGGGACATTGTGTCCCTCTATGCGGAGGGCAGCGTTTGCGGTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTTGAGCACACTCGGCCTGGTCGATGATCGCACAGTGGTGTGTCCCGAGGCCGGAGATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCAGCTGTCCGCCTAAGAAGTTCAGGGACTGCCTCATCAAAATATGCCCCATGAACCGCT 180

                          |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATTCTGCGCAGAAGCAATTTTGGAAAGCAGCTAAGCAATCGGCCAGCTCCAATACGGATC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAATCTCCTCAAGCGTTTGCATCATGCGGCGGAGATCGAGAAGAAACAAAACGAGACGG 300

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     301 AGAACAAGAAGCTGCTGGGCACC-TCAATCCAATATGGACGAGCTGTGGTGCAGCTACTG 360

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAT-TTGAAGTCCAACAAATATTTAACAGTTAACAAGCGACTGCCGTCGCTGCTGGAGAA 420

                          ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     421 GAATGCCATGCGCGTTTATCTGGATGCCAACGGGAACGAGGGGTCGTGGTTCTACATCAA 480

1063R-1.IR_full       481 GCCCTTCTANANGCTTCGCNCC 502
                          ||||||||| | ||||||| || silico     481 GCCCTTCTACAAGCTTCGCTCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169061.1  CG7896-RA (CG7896), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
100   482  NM_169060.1  CG7896-RA (CG7896), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0.2   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0.2   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0.2   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0.2   NM_141388.2  CG1249-RA (CG1249), mRNA 
0   NM_142467.2  CG7685-RA (CG7685), mRNA 
0   NM_170178.1  CG31381-RA (CG31381), mRNA 
0   NM_176539.1  CG33110-RA (CG33110), mRNA 
0   NM_164707.1  CG11199-RB, transcript variant B (Liprin-alpha), mRNA 
0   NM_135223.2  CG11199-RA, transcript variant A (Liprin-alpha), mRNA 
0   NM_132740.1  CG15890-RA (CG15890), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   12  NM_142405.1  CG18012-RA (CG18012), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_165623.1  CG30356-RA (CG30356), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_166338.1  CG11949-RD, transcript variant D (cora), mRNA 
0   NM_166336.1  CG11949-RC, transcript variant C (cora), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 
0   NM_135483.2  CG31712-RA (CG31712), mRNA 
0   NM_139978.3  CG6781-RA (CG6781), mRNA 
0   NM_169810.1  CG18617-RA, transcript variant A (Vha100-2), mRNA 
0   NM_142465.1  CG18617-RB, transcript variant B (Vha100-2), mRNA 
0   NM_138985.2  CG8947-RA (26-29-p), mRNA 
0   NM_168235.1  CG17888-RB, transcript variant B (Pdp1), mRNA 
0   NM_168236.1  CG17888-RG, transcript variant G (Pdp1), mRNA 
0   NM_139458.2  CG1317-RB (CG1317), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.