National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10618R-1 
 Symbol CHKov1  Full Name CHKov1 
 CG No CG10618  Old CG No CG10618 
 Synonyms CG10618, BcDNA:GH03753, CHKov1 
 Accession No (Link to NCBI) NM_170222.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGCCAAGAGCTATGAACTGA 
 Primer Seq. 3'
aatctagaggtaccGCCGTACTTCGAGACCTGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAGCCAAGAG CTATGAACTG AAGAATGCCC AGACCGAGTA CATATCTCTG GAGGATCTGT 
0061 GCATCAAAGG ATTTAAGAAC GCCAATCGCC TTGAGGGCCT CGATCAAGCG CACACGGAGC 
0121 GGGTTCTCCG GAAGTTGGCC CAGTGGCATG CTGCAACCGC CGTAAGGGTG GCCACTAAGG 
0181 GTCAGTATCC GGAAATCGTG CTGAACGGAT TCTTCAAGGA GGAAAACAGG CCGATGATGA 
0241 ACGATATGAT GAATGGCATG GGACAGGTGT TTGTCAAATG CTGTAGCACC TACGAAGGTA 
0301 ACGAGGCCTA TATAGAAAAA GTCAAAGCTC TTAAGGACGT GATGATAGAC GAGTTGTTTA 
0361 AGATGTGCGT AGTCGATCCC ACGGAGTTCA ACGTCCTGAA TCACGGTGAT TCTTGGTCCA 
0421 ATAACATTAT GTTTCAGTAT GATGAGTCTG GCAAAATCAA GGAGGTGTAT ATGGTCGACT 
0481 TTCAGGTCTC GAAGTACGGC  
 in silico PCR Fragment
0001 GAGCCAAGAG CTATGAACTG AAGAATGCCC AGACCGAGTA CATATCTCTG GAGGATCTGT 
0061 GCATCAAAGG ATTTAAGAAC GCCAATCGCC TTGAGGGCCT CGATCAAGCG CACACGGAGC 
0121 GGGTTCTCCG GAAGTTGGCC CAGTGGCATG CTGCAACCGC CGTAAGGGTG GCCACTAAGG 
0181 GTCAGTATCC GGAAATCGTG CTGAACGGAT TCTTCAAGGA GGAAAACAGG CCGATGATGA 
0241 ACGATATGAT GAATGGCATG GGACAGGTGT TTGTCAAATG CTGTAGCACC TACGAAGGTA 
0301 ACGAGGCCTA TATAGAAAAA GTCAAAGCTC TTAAGGACGT GATGATAGAC GAGTTGTTTA 
0361 AGATGTGCGT AGTCGATCCC ACGGAGTTCA ACGTCCTGAA TCACGGTGAT TCTTGGTCCA 
0421 ATAACATTAT GTTTCAGTAT GATGAGTCTG GCAAAATCAA GGAGGTGTAT ATGGTCGACT 
0481 TTCAGGTCTC GAAGTACGGC  
 Assemble Data

10618R-1.IR_full        1   AGCCAAGAGCTATGAACTGAAGAATGCCCAGACCGAGTACATATCTCTGGAGGATCTGT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico      1   AGCCAAGAGCTATGAACTGAAGAATGCCCAGACCGAGTACATATCTCTGGAGGATCTGT 59


10618R-1.IR_full       61  GCATCAAAGGATTTAAGAACGCCAATCGCCTTGAGGGCCTCGATCAAGCGCACACGGAGC 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     61  GCATCAAAGGATTTAAGAACGCCAATCGCCTTGAGGGCCTCGATCAAGCGCACACGGAGC 119


10618R-1.IR_full       121 GGGTTCTCCGGAAGTTGGCCCAGTGGCATGCTGCAACCGCCGTAAGGGTGGCCACTAAGG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     121 GGGTTCTCCGGAAGTTGGCCCAGTGGCATGCTGCAACCGCCGTAAGGGTGGCCACTAAGG 179


10618R-1.IR_full       181 GTCAGTATCCGGAAATCGTGCTGAACGGATTCTTCAAGGAGGAAAACAGGCCGATGATGA 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     181 GTCAGTATCCGGAAATCGTGCTGAACGGATTCTTCAAGGAGGAAAACAGGCCGATGATGA 239


10618R-1.IR_full       241 ACGATATGATGAATGGCATGGGACAGGTGTTTGTCAAATGCTGTAGCACCTACGAAGGTA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     241 ACGATATGATGAATGGCATGGGACAGGTGTTTGTCAAATGCTGTAGCACCTACGAAGGTA 299


10618R-1.IR_full       301 ACGAGGCCTATATAGAAAAAGTCAAAGCTCTTAAGGACGTGATGATAGACGAGTTGTTTA 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     301 ACGAGGCCTATATAGAAAAAGTCAAAGCTCTTAAGGACGTGATGATAGACGAGTTGTTTA 359


10618R-1.IR_full       361 AGATGTGCGTAGTCGATCCCACGGAGTTCAACGTCCTGAATCACGGTGATTCTTGGTCCA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     361 AGATGTGCGTAGTCGATCCCACGGAGTTCAACGTCCTGAATCACGGTGATTCTTGGTCCA 419


10618R-1.IR_full       421 ATAACATTATGTTTCAGTATGATGAGTCTGGCAAAATCAAGGAGGTGTATATGGTCGACT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10618R-1.in silico     421 ATAACATTATGTTTCAGTATGATGAGTCTGGCAAAATCAAGGAGGTGTATATGGTCGACT 479


10618R-1.IR_full       481 TTCAGGTCTCGAAGTACGGC 499
                           ||||||||||||||||||||
10618R-1.in silico     481 TTCAGGTCTCGAAGTACGGC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170222.1  CG10618-RA (CHKov1), mRNA 
0   10  54  85  NM_143128.2  CG10562-RA (CG10562), mRNA 
0   NM_141846.2  CG6830-RA (CG6830), mRNA 
0   14  NM_170213.2  CG31102-RA (CG31102), mRNA 
0   14  NM_143125.1  CG10559-RA (CG10559), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_079490.2  CG5837-RA (Hem), mRNA 
0   NM_169299.1  CG9495-RA (Scm), mRNA 
0   NM_206490.1  CG3631-RC, transcript variant C (CG3631), mRNA 
0   NM_169605.1  CG3631-RB, transcript variant B (CG3631), mRNA 
0   NM_142141.2  CG3631-RA, transcript variant A (CG3631), mRNA 
0   NM_165953.2  CG30486-RA (CG30486), mRNA 
0   NM_176565.1  CG31092-RB, transcript variant B (LpR2), mRNA 
0   NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0   NM_137662.1  CG11136-RA (CG11136), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_137541.2  CG15101-RA (Jheh1), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   24  NM_143130.2  CG10675-RA (CHKov2), mRNA 
0   13  NM_143127.2  CG10560-RA (CG10560), mRNA 
0   NM_170220.1  CG31099-RA (CG31099), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.