National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10618R-1 
 Symbol CHKov1  Full Name CHKov1 
 CG No CG10618  Old CG No CG10618 
 Synonyms CG10618, BcDNA:GH03753, CHKov1 
 Accession No (Link to NCBI) NM_170222.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   AGCCAAGAGCTATGAACTGAAGAATGCCCAGACCGAGTACATATCTCTGGAGGATCTGT 59

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCATCAAAGGATTTAAGAACGCCAATCGCCTTGAGGGCCTCGATCAAGCGCACACGGAGC 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGTTCTCCGGAAGTTGGCCCAGTGGCATGCTGCAACCGCCGTAAGGGTGGCCACTAAGG 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCAGTATCCGGAAATCGTGCTGAACGGATTCTTCAAGGAGGAAAACAGGCCGATGATGA 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGATATGATGAATGGCATGGGACAGGTGTTTGTCAAATGCTGTAGCACCTACGAAGGTA 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGAGGCCTATATAGAAAAAGTCAAAGCTCTTAAGGACGTGATGATAGACGAGTTGTTTA 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGATGTGCGTAGTCGATCCCACGGAGTTCAACGTCCTGAATCACGGTGATTCTTGGTCCA 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATAACATTATGTTTCAGTATGATGAGTCTGGCAAAATCAAGGAGGTGTATATGGTCGACT 479

10618R-1.IR_full       481 TTCAGGTCTCGAAGTACGGC 499
                           |||||||||||||||||||| silico     481 TTCAGGTCTCGAAGTACGGC 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170222.1  CG10618-RA (CHKov1), mRNA 
0   10  54  85  NM_143128.2  CG10562-RA (CG10562), mRNA 
0   NM_141846.2  CG6830-RA (CG6830), mRNA 
0   14  NM_170213.2  CG31102-RA (CG31102), mRNA 
0   14  NM_143125.1  CG10559-RA (CG10559), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_079490.2  CG5837-RA (Hem), mRNA 
0   NM_169299.1  CG9495-RA (Scm), mRNA 
0   NM_206490.1  CG3631-RC, transcript variant C (CG3631), mRNA 
0   NM_169605.1  CG3631-RB, transcript variant B (CG3631), mRNA 
0   NM_142141.2  CG3631-RA, transcript variant A (CG3631), mRNA 
0   NM_165953.2  CG30486-RA (CG30486), mRNA 
0   NM_176565.1  CG31092-RB, transcript variant B (LpR2), mRNA 
0   NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0   NM_137662.1  CG11136-RA (CG11136), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_137541.2  CG15101-RA (Jheh1), mRNA 
0   NM_135135.3  CG9098-RA, transcript variant A (CG9098), mRNA 
0   NM_164672.2  CG9098-RB, transcript variant B (CG9098), mRNA 
0   24  NM_143130.2  CG10675-RA (CHKov2), mRNA 
0   13  NM_143127.2  CG10560-RA (CG10560), mRNA 
0   NM_170220.1  CG31099-RA (CG31099), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.