National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1059R-2 
 Symbol Karybeta3  Full Name Karyopherin beta 3 
 CG No CG1059  Old CG No CG1059 
 Synonyms CG1059, l(3)j3A4, unnamed, l(3)j7E8, Karybeta3 
 Accession No (Link to NCBI) NM_079502.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCAGCGGATCAGGCCCAT 
 Primer Seq. 3'
aatctagaggtaccTGTACTGAGCTTCCTGGTTTC 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ATGGCAGCGG ATCAGGCCCA TTTCCAGCAG CTTCTGGCCT CCCTCTTGTC CACGGACAAC 
0061 GATGTTCGCC AGCAGGCGGA GTGAAGCATA CAACAATCTT TCAAGAGAGC TGAAGGTGAC 
0121 GCATCTCCTG GGCAACATCC AAAATGGCCA GCAGTCGGAG GAGGCTCGAC AGATGGCCGC 
0181 CGTGTTGCTG CGCCGCCTGT TTACCACCGA GTTCTTTGAT TTCTACAAAG GGCTTCCAGC 
0241 TGAATCCCAG AACCAATTGC TTCAGCAGAT CCTTTTGGCC GTGCAGCAGG AGGTGACGCC 
0301 GCAGCTGCGT CGCAAGATTT GCGAGGTAGT TGCCGAGGTG GCCAGGAATC TGATCGACGA 
0361 GGACTGCAAC AACCAGTGGC CCGACATCTT GCAGTTTCTC TTTCAATGCG CTAACTCGCC 
0421 TACGCCGCAG CTGCAGGAAT CGGCACTGCG GATCTTCTCT AGTGTGCCTT CCATATTTGG 
0481 AAACCAGGAA GCTCAGTACA  
 in silico PCR Fragment
0001 ATGGCAGCGG ATCAGGCCCA TTTCCAGCAG CTTCTGGCCT CCCTCTTGTC CACGGACAAC 
0061 GATGTTCGCC AGCAGGCGGA G-GAAGCATA CAACAATCTT TCAAGAGAGC TGAAGGTGAC 
0121 GCATCTCCTG GGCAACATCC AAAATGGCCA GCAGTCGGAG GAGGCTCGAC AGATGGCCGC 
0181 CGTGTTGCTG CGCCGCCTGT TTACCACCGA GTTCTTTGAT TTCTACAAAG GGCTTCCAGC 
0241 TGAATCCCAG AACCAATTGC TTCAGCAGAT CCTTTTGGCC GTGCAGCAGG AGGTGACGCC 
0301 GCAGCTGCGT CGCAAGATTT GCGAGGTAGT TGCCGAGGTG GCCAGGAATC TGATCGACGA 
0361 GGACTGCAAC AACCAGTGGC CCGACATCTT GCAGTTTCTC TTTCAATGCG CTAACTCGCC 
0421 TACGCCGCAG CTGCAGGAAT CGGCACTGCG GATCTTCTCT AGTGTGCCTT CCATATTTGG 
0481 AAACCAGGAA GCTCAGTACA  
 Assemble Data

1059R-2.IR_full       1   ATGGCAGCGGATCAGGCCCATTTCCAGCAGCTTCTGGCCTCCCTCTTGTCCACGGACAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     1   ATGGCAGCGGATCAGGCCCATTTCCAGCAGCTTCTGGCCTCCCTCTTGTCCACGGACAAC 60


1059R-2.IR_full       61  GATGTTCGCCAGCAGGCGGAGTGAAGCATACAACAATCTTTCAAGAGAGCTGAAGGTGAC 120
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     61  GATGTTCGCCAGCAGGCGGAG-GAAGCATACAACAATCTTTCAAGAGAGCTGAAGGTGAC 120


1059R-2.IR_full       121 GCATCTCCTGGGCAACATCCAAAATGGCCAGCAGTCGGAGGAGGCTCGACAGATGGCCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     121 GCATCTCCTGGGCAACATCCAAAATGGCCAGCAGTCGGAGGAGGCTCGACAGATGGCCGC 180


1059R-2.IR_full       181 CGTGTTGCTGCGCCGCCTGTTTACCACCGAGTTCTTTGATTTCTACAAAGGGCTTCCAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     181 CGTGTTGCTGCGCCGCCTGTTTACCACCGAGTTCTTTGATTTCTACAAAGGGCTTCCAGC 240


1059R-2.IR_full       241 TGAATCCCAGAACCAATTGCTTCAGCAGATCCTTTTGGCCGTGCAGCAGGAGGTGACGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     241 TGAATCCCAGAACCAATTGCTTCAGCAGATCCTTTTGGCCGTGCAGCAGGAGGTGACGCC 300


1059R-2.IR_full       301 GCAGCTGCGTCGCAAGATTTGCGAGGTAGTTGCCGAGGTGGCCAGGAATCTGATCGACGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     301 GCAGCTGCGTCGCAAGATTTGCGAGGTAGTTGCCGAGGTGGCCAGGAATCTGATCGACGA 360


1059R-2.IR_full       361 GGACTGCAACAACCAGTGGCCCGACATCTTGCAGTTTCTCTTTCAATGCGCTAACTCGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     361 GGACTGCAACAACCAGTGGCCCGACATCTTGCAGTTTCTCTTTCAATGCGCTAACTCGCC 420


1059R-2.IR_full       421 TACGCCGCAGCTGCAGGAATCGGCACTGCGGATCTTCTCTAGTGTGCCTTCCATATTTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1059R-2.in silico     421 TACGCCGCAGCTGCAGGAATCGGCACTGCGGATCTTCTCTAGTGTGCCTTCCATATTTGG 480


1059R-2.IR_full       481 AAACCAGGAAGCTCAGTACA 500
                          ||||||||||||||||||||
1059R-2.in silico     481 AAACCAGGAAGCTCAGTACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_079502.2  CG1059-RA (Karybeta3), mRNA 
0   NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0   NM_167504.1  CG12223-RB, transcript variant B (Dsp1), mRNA 
0   NM_167503.2  CG12223-RA, transcript variant A (Dsp1), mRNA 
0   NM_206762.1  CG12223-RE, transcript variant E (Dsp1), mRNA 
0   NM_080715.3  CG12223-RC, transcript variant C (Dsp1), mRNA 
0   NM_167502.2  CG12223-RD, transcript variant D (Dsp1), mRNA 
0   NM_138123.2  CG16912-RA (CG16912), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   17  NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_144103.1  CG13946-RA (CG13946), mRNA 
0   NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
0   NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
0   NM_135287.1  CG13792-RA (CG13792), mRNA 
0   14  NM_137533.3  CG15097-RA, transcript variant A (CG15097), mRNA 
0   14  NM_176232.1  CG15097-RB, transcript variant B (CG15097), mRNA 
0   NM_079117.2  CG3385-RA (nvy), mRNA 
0   NM_132159.1  CG1677-RA (CG1677), mRNA 
0   NM_141050.1  CG12972-RA (CG12972), mRNA 
0   NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   NM_001031916.1  CG1414-RC, transcript variant C (bbx), mRNA 
0   NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   NM_079587.2  CG4649-RA (Sodh-2), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_135469.2  CG1869-RA (CG1869), mRNA,4,5-triphosphate kinase 1 CG4026-RA (IP3K1), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_144442.2  CG18854-RC, transcript variant C (CG18854), mRNA 
0   NM_164872.1  CG18854-RA, transcript variant A (CG18854), mRNA 
0   NM_164873.1  CG18854-RB, transcript variant B (CG18854), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.