National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1058R-1 
 Symbol rpk  Full Name ripped pocket 
 CG No CG1058  Old CG No CG1058 
 Synonyms dGNaC1, RPK, GNaC1, CG1058, rpk 
 Accession No (Link to NCBI) NM_079501.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATATCGGATTCGGAACTCG 
 Primer Seq. 3'
aatctagaggtaccCGTGTTGCATACGTGCAGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCATATCGGA TTCGGAACTC GACAGCAGCA AGGGCATCGA CCTGACATTC AGGAGGAGAA 
0061 GGAAGGCAGG TTCCGTCGCC TGCGAAGGAT TTATCACCAC GTACCATGAA TACTGCAGGA 
0121 ACACTTCCAT ACATGGTGTC CAATATCTTG GCGAGCAGGA GCGCCCCTTC CGCGAGCGCA 
0181 TCTTTTGGCT GTTCGTGTTC CTGATCTCGA TCTACGGCTG CTCCACGCTG ATTCAAAGTG 
0241 CCTACACCAA GTGGACCGAA ACGCCTGTGA TCGTNTAGCT TCGCGGAAAA ATCGACCCCC 
0301 GTGTGGAACA TCCCGTTTCC GGCGGTCACA GTTTGCTCGG AGACCAAAAG GGTGCTAAAG 
0361 CAGAAAGGAA AAGAGACCAC TTATGCTGAT CTTTACAGCC AGTTCAGCGA AGATATGCga 
0421 GNTTCGCGGG TGTTTAGGCC CGAAAACGTT AGTGCCCTTG AGATGGAGGA GTTCCGCACC 
0481 CTGCTGCACG TATGCAACAC G 
 in silico PCR Fragment
0001 CCATATCGGA TTCGGAACTC GACAGCAGCA AGGGCATCGA CCTGACATTC AGGAGGAGAA 
0061 GGAAGGCAGG TTCCGTCGCC TGCGAAGGAT TTATCACCAC GTACCATGAA TACTGCAGGA 
0121 ACACTTCCAT ACATGGTGTC CAATATCTTG GCGAGCAGGA GCGCCCCTTC CGCGAGCGCA 
0181 TCTTTTGGCT GTTCGTGTTC CTGATCTCGA TCTACGGCTG CTCCACGCTG ATTCAAAGTG 
0241 CCTACACCAA GTGGACCGAA ACGCCTGTGA TCGT-TAGCT TCGCGGAAAA ATCGACCCCC 
0301 GTGTGGAACA TCCCGTTTCC GGCGGTCACA GTTTGCTCGG AGACCAAAAG GGTGCTAAAG 
0361 CAGAAAGGAA AAGAGACCAC TTATGCTGAT CTTTACAGCC AGTTCAGCGA AGATATGCGA 
0421 GCTTCGCGGG TGTTTAGGCC CGAAAACGTT AGTGCCCTTG AGATGGAGGA GTTCCGCACC 
0481 CTGCTGCACG TATGCAACAC G 
 Assemble Data

1058R-1.IR_full       1   CCATATCGGATTCGGAACTCGACAGCAGCAAGGGCATCGACCTGACATTCAGGAGGAGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     1   CCATATCGGATTCGGAACTCGACAGCAGCAAGGGCATCGACCTGACATTCAGGAGGAGAA 60


1058R-1.IR_full       61  GGAAGGCAGGTTCCGTCGCCTGCGAAGGATTTATCACCACGTACCATGAATACTGCAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     61  GGAAGGCAGGTTCCGTCGCCTGCGAAGGATTTATCACCACGTACCATGAATACTGCAGGA 120


1058R-1.IR_full       121 ACACTTCCATACATGGTGTCCAATATCTTGGCGAGCAGGAGCGCCCCTTCCGCGAGCGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     121 ACACTTCCATACATGGTGTCCAATATCTTGGCGAGCAGGAGCGCCCCTTCCGCGAGCGCA 180


1058R-1.IR_full       181 TCTTTTGGCTGTTCGTGTTCCTGATCTCGATCTACGGCTGCTCCACGCTGATTCAAAGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     181 TCTTTTGGCTGTTCGTGTTCCTGATCTCGATCTACGGCTGCTCCACGCTGATTCAAAGTG 240


1058R-1.IR_full       241 CCTACACCAAGTGGACCGAAACGCCTGTGATCGTNTAGCTTCGCGGAAAAATCGACCCCC 300
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
1058R-1.in silico     241 CCTACACCAAGTGGACCGAAACGCCTGTGATCGT-TAGCTTCGCGGAAAAATCGACCCCC 300


1058R-1.IR_full       301 GTGTGGAACATCCCGTTTCCGGCGGTCACAGTTTGCTCGGAGACCAAAAGGGTGCTAAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     301 GTGTGGAACATCCCGTTTCCGGCGGTCACAGTTTGCTCGGAGACCAAAAGGGTGCTAAAG 360


1058R-1.IR_full       361 CAGAAAGGAAAAGAGACCACTTATGCTGATCTTTACAGCCAGTTCAGCGAAGATATGCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     361 CAGAAAGGAAAAGAGACCACTTATGCTGATCTTTACAGCCAGTTCAGCGAAGATATGCGA 420


1058R-1.IR_full       421 GNTTCGCGGGTGTTTAGGCCCGAAAACGTTAGTGCCCTTGAGATGGAGGAGTTCCGCACC 480
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1058R-1.in silico     421 GCTTCGCGGGTGTTTAGGCCCGAAAACGTTAGTGCCCTTGAGATGGAGGAGTTCCGCACC 480


1058R-1.IR_full       481 CTGCTGCACGTATGCAACACG 501
                          |||||||||||||||||||||
1058R-1.in silico     481 CTGCTGCACGTATGCAACACG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.