National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10580R-2 
 Symbol fng  Full Name fringe 
 CG No CG10580  Old CG No CG10580 
 Synonyms Dfng, CG10580, D-Fng, l(3)rG554, frg, fg, Frg, D-fng, fng, Fng 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAAGCCATGATGTTAGCCGT 
 Primer Seq. 3'
aatctagaggtaccTGAAGAACCAGGTCTGATCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10580R-2.IR full       1   GCAAGCCATGATGTTAGCCGTCGCCGTCGTCTATATGACCCTACTGCTCTACCAGAGCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     1   GCAAGCCATGATGTTAGCCGTCGCCGTCGTCTATATGACCCTACTGCTCTACCAGAGCGC 60


10580R-2.IR full       61  CTACGGATATCCGGGCATCCAAGTGCCGCACAGCCAGGTGGATGCCCTTGCCAGCGAAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     61  CTACGGATATCCGGGCATCCAAGTGCCGCACAGCCAGGTGGATGCCCTTGCCAGCGAAGC 120


10580R-2.IR full       121 CGTGACCACACATCGCGACCAGCTGCTCCAGGACTACGTGCAGTCCTCCACGCCCACCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     121 CGTGACCACACATCGCGACCAGCTGCTCCAGGACTACGTGCAGTCCTCCACGCCCACCCA 180


10580R-2.IR full       181 GCCGGGGGCTGGAGCTCCGGCCGCCTCCCCCACCACCGTCATAATCCGCAAGGATATACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     181 GCCGGGGGCTGGAGCTCCGGCCGCCTCCCCCACCACCGTCATAATCCGCAAGGATATACG 240


10580R-2.IR full       241 CAGCTTCAATTTCAGCGACATCGAGGTCAGTGAGCGGCCCACGGCCACGCTGCTAACAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     241 CAGCTTCAATTTCAGCGACATCGAGGTCAGTGAGCGGCCCACGGCCACGCTGCTAACAGA 300


10580R-2.IR full       301 ATTGGCCAGAAGGAGCCGGAATGGGGAACTGCTCCGCGATCTGTCCCAAAGAGCGGTGAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     301 ATTGGCCAGAAGGAGCCGGAATGGGGAACTGCTCCGCGATCTGTCCCAAAGAGCGGTGAC 360


10580R-2.IR full       361 GGCGACACCACAGCCGCCGGTCACCGAGTTGGATGACATTTTCATCAGCGTAAAGACGAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     361 GGCGACACCACAGCCGCCGGTCACCGAGTTGGATGACATTTTCATCAGCGTAAAGACGAC 420


10580R-2.IR full       421 GAAGAACTATCACGACACCCGGCTGGCGTTGATCATCAAGACCTGGTTCCAATTGGCCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-2.in silico     421 GAAGAACTATCACGACACCCGGCTGGCGTTGATCATCAAGACCTGGTTCCAATTGGCCCG 480


10580R-2.IR full       481 CGATCAGACCTGGTTCTTCA 500
                           ||||||||||||||||||||
10580R-2.in silico     481 CGATCAGACCTGGTTCTTCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079467.2  fringe CG10580-RA (fng), mRNA 
21  NM_132386.2  Interaction partner of Dnmt2 CG2961-RA (Ipod), mRNA 
10  NM_001042891.1  bruno-2 CG31761-RE, transcript variant E (bru-2), mRNA 
NM_079664.1  Salivary gland secretion 5 CG7596-RA (Sgs5), mRNA 
NM_136798.1  skiff CG30021-RA (skf), mRNA 
NM_166978.1  CG13021-RC, transcript variant C (CG13021), mRNA 
NM_166976.1  CG32791-RA (CG32791), mRNA 
NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
NM_130621.2  CG4061-RA (CG4061), mRNA 
NM_001038810.1  porin CG6647-RC, transcript variant C (porin), mRNA 
NM_135123.2  CG9021-RA (CG9021), mRNA 
NM_143770.2  lethal (2) 01424 CG3845-RB, transcript variant B (l(2)01424), mRNA 
NM_001038854.1  lethal (2) 01424 CG3845-RC, transcript variant C (l(2)01424), mRNA 
NM_165961.1  lethal (2) 01424 CG3845-RA, transcript variant A (l(2)01424), mRNA 
NM_132773.2  rab3-GEF CG5627-RA (rab3-GEF), mRNA 
NM_164989.1  rab3-GAP CG7061-RB, transcript variant B (rab3-GAP), mRNA 
NM_135700.3  rab3-GAP CG7061-RA, transcript variant A (rab3-GAP), mRNA 
NM_134876.1  CG18558-RA (CG18558), mRNA 
NM_080378.2  UDP-GlcNAc:a-3-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase I CG13431-RA (Mgat1), mRNA 
NM_169858.1  CG5316-RC, transcript variant C (CG5316), mRNA 
NM_079817.2  Dynein heavy chain at 89D CG1842-RA (Dhc98D), mRNA 
NM_169740.1  Daughters against dpp CG5201-RB, transcript variant B (Dad), mRNA 
NM_143050.1  CG11069-RA (CG11069), mRNA 
NM_001014629.1  Daughters against dpp CG5201-RC, transcript variant C (Dad), mRNA 
NM_057912.3  Daughters against dpp CG5201-RA, transcript variant A (Dad), mRNA 
NM_137672.1  CG15225-RA (CG15225), mRNA 
NM_134701.2  CG3883-RA (CG3883), mRNA 
22  NM_078641.2  cabeza CG3606-RB, transcript variant B (caz), mRNA 
22  NM_167493.1  cabeza CG3606-RA, transcript variant A (caz), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.