National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10580R-1 
 Symbol fng  Full Name fringe 
 CG No CG10580  Old CG No CG10580 
 Synonyms Dfng, CG10580, D-Fng, l(3)rG554, frg, fg, Frg, D-fng, fng, Fng 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAAGCCATGATGTTAGCCGT 
 Primer Seq. 3'
aatctagaggtaccTGAAGAACCAGGTCTGATCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10580R-1.IR full       1   GCAAGCCATGATGTTAGCCGTCGCCGTCGTCTATATGACCCTACTGCTCTACCAGAGCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     1   GCAAGCCATGATGTTAGCCGTCGCCGTCGTCTATATGACCCTACTGCTCTACCAGAGCGC 60


10580R-1.IR full       61  CTACGGATATCCGGGCATCCAAGTGCCGCACAGCCAGGTGGATGCCCTTGCCAGCGAAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     61  CTACGGATATCCGGGCATCCAAGTGCCGCACAGCCAGGTGGATGCCCTTGCCAGCGAAGC 120


10580R-1.IR full       121 CGTGACCACACATCGCGACCAGCTGCTCCAGGACTACGTGCAGTCCTCCACGCCCACCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     121 CGTGACCACACATCGCGACCAGCTGCTCCAGGACTACGTGCAGTCCTCCACGCCCACCCA 180


10580R-1.IR full       181 GCCGGGGGCTGGAGCTCCGGCCGCCTCCCCCACCACCGTCATAATCCGCAAGGATATACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     181 GCCGGGGGCTGGAGCTCCGGCCGCCTCCCCCACCACCGTCATAATCCGCAAGGATATACG 240


10580R-1.IR full       241 CAGCTTCAATTTCAGCGACATCGAGGTCAGTGAGCGGCCCACGGCCACGCTGCTAACAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     241 CAGCTTCAATTTCAGCGACATCGAGGTCAGTGAGCGGCCCACGGCCACGCTGCTAACAGA 300


10580R-1.IR full       301 ATTGGCCAGAAGGAGCCGGAATGGGGAACTGCTCCGCGATCTGTCCCAAAGAGCGGTGAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     301 ATTGGCCAGAAGGAGCCGGAATGGGGAACTGCTCCGCGATCTGTCCCAAAGAGCGGTGAC 360


10580R-1.IR full       361 GGCGACACCACAGCCGCCGGTCACCGAGTTGGATGACATTTTCATCAGCGTAAAGACGAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     361 GGCGACACCACAGCCGCCGGTCACCGAGTTGGATGACATTTTCATCAGCGTAAAGACGAC 420


10580R-1.IR full       421 GAAGAACTATCACGACACCCGGCTGGCGTTGATCATCAAGACCTGGTTCCAATTGGCCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10580R-1.in silico     421 GAAGAACTATCACGACACCCGGCTGGCGTTGATCATCAAGACCTGGTTCCAATTGGCCCG 480


10580R-1.IR full       481 CGATCAGACCTGGTTCTTCA 500
                           ||||||||||||||||||||
10580R-1.in silico     481 CGATCAGACCTGGTTCTTCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_079467.2  fringe CG10580-RA (fng), mRNA 
21  NM_132386.2  Interaction partner of Dnmt2 CG2961-RA (Ipod), mRNA 
10  NM_001042891.1  bruno-2 CG31761-RE, transcript variant E (bru-2), mRNA 
NM_079664.1  Salivary gland secretion 5 CG7596-RA (Sgs5), mRNA 
NM_136798.1  skiff CG30021-RA (skf), mRNA 
NM_166978.1  CG13021-RC, transcript variant C (CG13021), mRNA 
NM_166976.1  CG32791-RA (CG32791), mRNA 
NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
NM_130621.2  CG4061-RA (CG4061), mRNA 
NM_001038810.1  porin CG6647-RC, transcript variant C (porin), mRNA 
NM_135123.2  CG9021-RA (CG9021), mRNA 
NM_143770.2  lethal (2) 01424 CG3845-RB, transcript variant B (l(2)01424), mRNA 
NM_001038854.1  lethal (2) 01424 CG3845-RC, transcript variant C (l(2)01424), mRNA 
NM_165961.1  lethal (2) 01424 CG3845-RA, transcript variant A (l(2)01424), mRNA 
NM_132773.2  rab3-GEF CG5627-RA (rab3-GEF), mRNA 
NM_164989.1  rab3-GAP CG7061-RB, transcript variant B (rab3-GAP), mRNA 
NM_135700.3  rab3-GAP CG7061-RA, transcript variant A (rab3-GAP), mRNA 
NM_134876.1  CG18558-RA (CG18558), mRNA 
NM_080378.2  UDP-GlcNAc:a-3-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase I CG13431-RA (Mgat1), mRNA 
NM_169858.1  CG5316-RC, transcript variant C (CG5316), mRNA 
NM_079817.2  Dynein heavy chain at 89D CG1842-RA (Dhc98D), mRNA 
NM_169740.1  Daughters against dpp CG5201-RB, transcript variant B (Dad), mRNA 
NM_143050.1  CG11069-RA (CG11069), mRNA 
NM_001014629.1  Daughters against dpp CG5201-RC, transcript variant C (Dad), mRNA 
NM_057912.3  Daughters against dpp CG5201-RA, transcript variant A (Dad), mRNA 
NM_137672.1  CG15225-RA (CG15225), mRNA 
NM_134701.2  CG3883-RA (CG3883), mRNA 
22  NM_078641.2  cabeza CG3606-RB, transcript variant B (caz), mRNA 
22  NM_167493.1  cabeza CG3606-RA, transcript variant A (caz), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.