National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10579R-3 
 Symbol Eip63E  Full Name Ecdysone-induced protein 63E 
 CG No CG10579  Old CG No CG10579 
 Synonyms PFTAIRE, cdc2-63E, L63, CG10579, Eip63E 
 Accession No (Link to NCBI) NM_168034.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCGTCACAATGCGCGAGAA 
 Primer Seq. 3'
aatctagaggtaccGGGAGTCGCCACCAAATGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCGTCACA ATGCGCGAGA AAAAGGGAGG AGCCCTTCAG AAGCTCAAGA AGAGACTTTC 
0061 GCACAGCTTC GGCAGATTAA CAATTTCCCG CGAAGATGGC GACGAGTCGA CGCACCACCA 
0121 TCACCACCAC CATCATCATC GCGGTGGACA TGGCGGGCAC CACAACCACG GTAACAAAGT 
0181 TCCATACAAC GGCTACAATT CGGAGGAATA CTTGGACCGA CTCGAACCGA ATGGCAATAT 
0241 ACCCGCTGAC AAGACAAATT GCAGATATGG AGACTGGCGC AGCACGGACA GCACGGACCA 
0301 CCACGATCGC GTCCAGAGAC AGCTTTCCGT GTCCTCCGAC AGCAAGTTGC TCGACGAGGA 
0361 CATTCGCGAG GAGATGAAGT ACCATTCGCA CGTGGTCATG CGTCCCAAGA AGCCGCCCAG 
0421 ACCCAAGTCC GAGGTCTTTT TGAACAAACA GGAAACGCAT CCGCGCCGGA AACGATTCAG 
0481 TGCATTTGGT GGCGACTCCC  
 in silico PCR Fragment
0001 CGGCGTCACA ATGCGCGAGA AAAAGGGAGG AGCCCTTCAG AAGCTCAAGA AGAGACTTTC 
0061 GCACAGCTTC GGCAGATTAA CAATTTCCCG CGAAGATGGC GACGAGTCGA CGCACCACCA 
0121 TCACCACCAC CATCATCATC GCGGTGGACA TGGCGGGCAC CACAACCACG GTAACAAAGT 
0181 TCCATACAAC GGCTACAATT CGGAGGAATA CTTGGACCGA CTCGAACCGA ATGGCAATAT 
0241 ACCCGCTGAC AAGACAAATT GCAGATATGG AGACTGGCGC AGCACGGACA GCACCGACCA 
0301 CCACGATCGC GTCCAGAGAC AGCTTTCCGT GTCCTCCGAC AGCAAGTTGC TCGACGAGGA 
0361 CATTCGCGAG GAGATGAAGT ACCATTCGCA CGTGGTCATG CGTCCCAAGA AGCCGCCCAG 
0421 ACCCAAATCC GAGGTCTTTC TGAACAAACA GGAAACGCAT CCGCGCCGGA AACGATTCAG 
0481 TGCATTTGGT GGCGACTCCC  
 Assemble Data

10579R-3.IR_full       1   CGGCGTCACAATGCGCGAGAAAAAGGGAGGAGCCCTTCAGAAGCTCAAGAAGAGACTTTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     1   CGGCGTCACAATGCGCGAGAAAAAGGGAGGAGCCCTTCAGAAGCTCAAGAAGAGACTTTC 60


10579R-3.IR_full       61  GCACAGCTTCGGCAGATTAACAATTTCCCGCGAAGATGGCGACGAGTCGACGCACCACCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     61  GCACAGCTTCGGCAGATTAACAATTTCCCGCGAAGATGGCGACGAGTCGACGCACCACCA 120


10579R-3.IR_full       121 TCACCACCACCATCATCATCGCGGTGGACATGGCGGGCACCACAACCACGGTAACAAAGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     121 TCACCACCACCATCATCATCGCGGTGGACATGGCGGGCACCACAACCACGGTAACAAAGT 180


10579R-3.IR_full       181 TCCATACAACGGCTACAATTCGGAGGAATACTTGGACCGACTCGAACCGAATGGCAATAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     181 TCCATACAACGGCTACAATTCGGAGGAATACTTGGACCGACTCGAACCGAATGGCAATAT 240


10579R-3.IR_full       241 ACCCGCTGACAAGACAAATTGCAGATATGGAGACTGGCGCAGCACGGACAGCACGGACCA 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10579R-3.in silico     241 ACCCGCTGACAAGACAAATTGCAGATATGGAGACTGGCGCAGCACGGACAGCACCGACCA 300


10579R-3.IR_full       301 CCACGATCGCGTCCAGAGACAGCTTTCCGTGTCCTCCGACAGCAAGTTGCTCGACGAGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     301 CCACGATCGCGTCCAGAGACAGCTTTCCGTGTCCTCCGACAGCAAGTTGCTCGACGAGGA 360


10579R-3.IR_full       361 CATTCGCGAGGAGATGAAGTACCATTCGCACGTGGTCATGCGTCCCAAGAAGCCGCCCAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     361 CATTCGCGAGGAGATGAAGTACCATTCGCACGTGGTCATGCGTCCCAAGAAGCCGCCCAG 420


10579R-3.IR_full       421 ACCCAAGTCCGAGGTCTTTTTGAACAAACAGGAAACGCATCCGCGCCGGAAACGATTCAG 480
                           |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||
10579R-3.in silico     421 ACCCAAATCCGAGGTCTTTCTGAACAAACAGGAAACGCATCCGCGCCGGAAACGATTCAG 480


10579R-3.IR_full       481 TGCATTTGGTGGCGACTCCC 500
                           ||||||||||||||||||||
10579R-3.in silico     481 TGCATTTGGTGGCGACTCCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_168034.1  CG10579-RA, transcript variant A (Eip63E), mRNA 
100   482  16  NM_168035.1  CG10579-RB, transcript variant B (Eip63E), mRNA 
100   482  16  NM_168036.1  CG10579-RC, transcript variant C (Eip63E), mRNA 
100   482  16  NM_001043121.1  CG10579-RJ, transcript variant J (Eip63E), mRNA 
99.79   481  16  NM_001043116.1  CG10579-RF, transcript variant F (Eip63E), mRNA 
96.68   466  18  NM_001043119.1  CG10579-RI, transcript variant I (Eip63E), mRNA 
96.68   466  18  NM_001043120.1  CG10579-RG, transcript variant G (Eip63E), mRNA 
96.68   466  18  NM_001043118.1  CG10579-RK, transcript variant K (Eip63E), mRNA 
96.47   465  18  NM_079180.2  CG10579-RD, transcript variant D (Eip63E), mRNA 
96.47   465  18  NM_168033.1  CG10579-RE, transcript variant E (Eip63E), mRNA 
96.26   464  18  NM_001043117.1  CG10579-RH, transcript variant H (Eip63E), mRNA 
1.03   13  50  NM_132420.2  CG32676-RA (CG32676), mRNA 
0.41   12  24  38  NM_137883.1  CG13535-RA (CG13535), mRNA 
0.41   11  24  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.41   11  24  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.41   19  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0.41   19  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0.41   27  56  NM_136646.1  CG13953-RA (CG13953), mRNA 
0.41   15  51  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.41   15  17  NM_140443.1  CG13482-RA (CG13482), mRNA 
0.41   13  33  NM_168560.1  CG32132-RA (CG32132), mRNA 
0.41   17  NM_143196.1  CG8968-RA (CG8968), mRNA 
0.41   17  NM_132086.1  CG15894-RA (CG15894), mRNA 
0.41   14  NM_141046.3  CG7605-RA (Rab26), mRNA 
0.41   32  NM_168240.1  CG32365-RA (CG32365), mRNA 
0.41   14  23  NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0.41   14  23  NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0.41   14  23  NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0.41   16  NM_001031952.1  CG11714-RA, transcript variant A (CG11714), mRNA 
0.41   16  NM_001031953.1  CG6128-RA, transcript variant A (CG6128), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.