National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10574R-2 
 Symbol I-2  Full Name Inhibitor-2 
 CG No CG10574  Old CG No CG10574 
 Synonyms I-2Dm, Dm I-2, CG10574, I-2, Inhibitor-2, inhibitor-2, I-2PP1 
 Accession No (Link to NCBI) NM_079289.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     1   AGCCCACAGCTACCCTGCAAGGGTATACTAAAGACTTCGCGTAGCTTCGACAAGTCGGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCAGTTTTCGCAAAAGTGCCAAGTTCGATGAGCTGAACGTGATGCAGACCTTCCATCCG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGACAAGGACTACGGACACATGAAAATCGATGAGCCCAAAACGCCGTACAACTACACG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGGGCTTCGACGAGAACAGGGACGAGCTGGACACGGAGTTGCTAGTGGAGAAACTCCGC 240

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATAGCGGCT-AACACACAGCCGTCGACAGAGAGCATCGAGGACGATGGTTCCTCCGGTGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||  |||| silico     301 TGACCAGCCCCTTAGCGAAGAGGAGCGACAACGGCGGCGCGAATTCGA-GCGACGCCGTA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGCCCACTATCGCGAGTTTGAGGCCGTCAAACTGGCACGAAAACTGATCCAGGAGGAGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGACGACGATGACGACGAGGACAAGGGTGCGGATAGCCGGCCCTCGGGCTCGTCACAGG 480

10574R-2.IR_full       481 GCNCTTCCAGCTCCGGACGTTT 502
                           || ||||||||||||||||||| silico     481 GCGCTTCCAGCTCCGGACGTTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  21  NM_079289.2  CG10574-RA (I-2), mRNA 
1.65   27  NM_167022.1  CG32771-RA (CG32771), mRNA 
0.82   18  NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0.82   18  NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0.82   28  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.82   18  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.62   19  26  82  NM_132412.1  CG9817-RA (CG9817), mRNA 
0.62   13  NM_079106.2  CG4817-RA (Ssrp), mRNA 
0.62   51  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0.62   38  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0.41   11  36  NM_078981.2  CG8967-RA (otk), mRNA 
0.41   22  51  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0.41   16  30  NM_132548.2  CG15736-RA (Chrac-16), mRNA 
0.41   NM_136906.1  CG13170-RA (CG13170), mRNA 
0.41   11  NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0.41   11  NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0.2   13  23  32  NM_079842.2  CG17958-RA (Sry-delta), mRNA 
0.2   12  23  30  NM_132095.2  CG3918-RA (CG3918), mRNA 
0.2   11  25  NM_142921.2  CG10225-RA (CG10225), mRNA 
0.2   31  NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0.2   31  NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0.2   34  NM_131944.1  CG3546-RA (CG3546), mRNA 
0.2   18  45  NM_137261.1  CG15709-RA (CG15709), mRNA 
0.2   12  32  NM_143801.2  CG5935-RB, transcript variant B (Dek), mRNA 
0.2   12  32  NM_166198.1  CG5935-RC, transcript variant C (Dek), mRNA 
0.2   12  32  NM_206139.2  CG5935-RD, transcript variant D (Dek), mRNA 
0.2   12  32  NM_166199.2  CG5935-RA, transcript variant A (Dek), mRNA 
0.2   NM_139419.1  CG13925-RA (CG13925), mRNA 
0   15  20  41  NM_141852.1  CG12594-RA (CG12594), mRNA 
0   12  12  22  NM_078601.2  CG9533-RA (rut), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.