National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10572R-1 
 Symbol Cdk8  Full Name Cyclin-dependent kinase 8 
 CG No CG10572  Old CG No CG10572 
 Synonyms cdk8, CDK8, p58, CG10572, dTRAP56, DmCdk8, Cdk8 
 Accession No (Link to NCBI) NM_080487.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mao F, Yang X, Fu L, Lv X, Zhang Z, Wu W, Yang S, Zhou Z, Zhang L, Zhao Y.
The Kto-Skd complex can regulate ptc expression by interacting with Cubitus interruptus (Ci) in the Hedgehog signaling pathway.
J Biol Chem. (2014) 289(32) 22333-41 [ PubMed ID = 24962581 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCAACTACGAGGGCTGTAAG 
 Primer Seq. 3'
aatctagaggtaccGGTTTCAATGGGGCATTGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCAACTACG AGGGCTGTAA GGTGGGACGC GGAACATACG GCCACGTCTA CAAGGCGAAA 
0061 TGGAAGGAGA CAAGCGATGG CAAAGAATAT GCCTTGAAGC AGATCGACGG CACCGGATTG 
0121 TCCATGTCCG CCTGCCGCGA GANTCGCATT GCTGCGCGAA CTGAAGCATC AGAACGTAAT 
0181 TACCCTCATC CGTGTGTTTC TGTCGCACAA CGACCGCAAG GTGTTCCTGT TGATCGACTA 
0241 TGCGGAGCAC GACCTGTGGC ACATCATTAA GTTCCATNCG GGCTGCTAAG GCCACCAAAA 
0301 AGCAGGTTGT CGTTNCCCCG CGGTATGGTT AAAAGTCTGC TATATCAGAT TCTGGATGGG 
0361 ATTCACTATC TGCACAGNAA TTGGGTGCTA CATCGTGACC TGAAGCCGGC CAACATCCTG 
0421 GTGATGGGCG ATGGCAACGA GAGGGGCCGC GTAAAAATCG CCGACATGGG TTNCGCGCGG 
0481 CTCTTCAATG CCCCATTGAA ACC 
 in silico PCR Fragment
0001 TTCAACTACG AGGGCTGTAA GGTGGGACGC GGAACATACG GCCACGTCTA CAAGGCGAAA 
0061 TGGAAGGAGA CAAGCGATGG CAAAGAATAT GCCTTGAAGC AGATCGACGG CACCGGATTG 
0121 TCCATGTCCG CCTGCCGCGA GA-TCGCATT GCTGCGCGAA CTGAAGCATC AGAACGTAAT 
0181 TACCCTCATC CGGGTGTTTC TGTCGCACAA CGACCGCAAG GTGTTCCTGT TGATCGACTA 
0241 TGCGGAGCAC GACCTGTGGC ACATCATTAA GTTCCAT-CG GGCTGCTAAG GCCACCAAAA 
0301 AGCAGGTTGT GGTT-CCCCG CGGTATGGTT AAAAGTCTGC TATATCAGAT TCTGGATGGG 
0361 ATTCACTATC TGCACAGTAA TTGGGTGCTA CATCGTGACC TGAAGCCGGC CAACATCCTG 
0421 GTGATGGGCG ATGGCAACGA GAGGGGCCGC GTAAAAATCG CCGACATGGG TTTCGCGCGG 
0481 CTCTTCAATG CCCCATTGAA ACC 
 Assemble Data

10572R-1.IR_full       1   TTCAACTACGAGGGCTGTAAGGTGGGACGCGGAACATACGGCCACGTCTACAAGGCGAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10572R-1.in silico     1   TTCAACTACGAGGGCTGTAAGGTGGGACGCGGAACATACGGCCACGTCTACAAGGCGAAA 60


10572R-1.IR_full       61  TGGAAGGAGACAAGCGATGGCAAAGAATATGCCTTGAAGCAGATCGACGGCACCGGATTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10572R-1.in silico     61  TGGAAGGAGACAAGCGATGGCAAAGAATATGCCTTGAAGCAGATCGACGGCACCGGATTG 120


10572R-1.IR_full       121 TCCATGTCCGCCTGCCGCGAGANTCGCATTGCTGCGCGAACTGAAGCATCAGAACGTAAT 180
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10572R-1.in silico     121 TCCATGTCCGCCTGCCGCGAGA-TCGCATTGCTGCGCGAACTGAAGCATCAGAACGTAAT 180


10572R-1.IR_full       181 TACCCTCATCCGTGTGTTTCTGTCGCACAACGACCGCAAGGTGTTCCTGTTGATCGACTA 240
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
10572R-1.in silico     181 TACCCTCATCCGGGTGTTTCTGTCGCACAACGACCGCAAGGTGTTCCTGTTGATCGACTA 240


10572R-1.IR_full       241 TGCGGAGCACGACCTGTGGCACATCATTAAGTTCCATNCGGGCTGCTAAGGCCACCAAAA 300
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
10572R-1.in silico     241 TGCGGAGCACGACCTGTGGCACATCATTAAGTTCCAT-CGGGCTGCTAAGGCCACCAAAA 300


10572R-1.IR_full       301 AGCAGGTTGTCGTTNCCCCGCGGTATGGTTAAAAGTCTGCTATATCAGATTCTGGATGGG 360
                           |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||
10572R-1.in silico     301 AGCAGGTTGTGGTT-CCCCGCGGTATGGTTAAAAGTCTGCTATATCAGATTCTGGATGGG 360


10572R-1.IR_full       361 ATTCACTATCTGCACAGNAATTGGGTGCTACATCGTGACCTGAAGCCGGCCAACATCCTG 420
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
10572R-1.in silico     361 ATTCACTATCTGCACAGTAATTGGGTGCTACATCGTGACCTGAAGCCGGCCAACATCCTG 420


10572R-1.IR_full       421 GTGATGGGCGATGGCAACGAGAGGGGCCGCGTAAAAATCGCCGACATGGGTTNCGCGCGG 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
10572R-1.in silico     421 GTGATGGGCGATGGCAACGAGAGGGGCCGCGTAAAAATCGCCGACATGGGTTTCGCGCGG 480


10572R-1.IR_full       481 CTCTTCAATGCCCCATTGAAACC 503
                           |||||||||||||||||||||||
10572R-1.in silico     481 CTCTTCAATGCCCCATTGAAACC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080487.2  CG10572-RA (Cdk8), mRNA 
0   12  NM_057623.3  CG5974-RA (pll), mRNA 
0   NM_206685.1  CG1743-RA, transcript variant A (Gs2), mRNA 
0   NM_078568.2  CG1743-RC, transcript variant C (Gs2), mRNA 
0   NM_167284.1  CG1743-RB, transcript variant B (Gs2), mRNA 
0   NM_136582.2  CG8235-RA (CG8235), mRNA 
0   NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_170613.2  CG30492-RA, transcript variant A (CG30492), mRNA 
0   NM_176100.1  CG30492-RC, transcript variant C (CG30492), mRNA 
0   NM_170614.2  CG30492-RB, transcript variant B (CG30492), mRNA 
0   NM_176101.1  CG30492-RE, transcript variant E (CG30492), mRNA 
0   NM_133011.2  CG8173-RA (CG8173), mRNA 
0   NM_132537.1  CG15738-RA (CG15738), mRNA 
0   NM_137027.1  CG4744-RA (CG4744), mRNA 
0   NM_001014622.1  CG33555-RA, transcript variant A (btsz), mRNA 
0   NM_001014625.1  CG33555-RB, transcript variant B (btsz), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_001014623.1  CG33555-RD, transcript variant D (btsz), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0   NM_136670.2  CG1776-RA (CG1776), mRNA 
0   NM_079821.2  CG1954-RA (Pkc98E), mRNA 
0   NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_140214.2  CG7512-RA (CG7512), mRNA 
0   NM_132679.1  CG12176-RA (Lig4), mRNA 
0   NM_078908.2  CG12845-RA (Tsp42Ef), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.