National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10532R-1 
 Symbol CG32944  Full Name CG32944 
 CG No CG32944  Old CG No CG10532 
 Synonyms CG9818, CG10532, CG32944 
 Accession No (Link to NCBI) NM_176397.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACTCGAACACCCCACTAGC 
 Primer Seq. 3'
aatctagaggtaccTCTCTTGGATGGGGGCCAAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACTCGAAC ACCCCACTAG CGGAGATCAA GAATATATTG AACACCCCCG TGCACTATCC 
0061 GCGCTACTGG AGCAGCAACT TCGTCGATCT GCTGCAGAGG TTACTTTCCA CCTATCCGGG 
0121 TGCTAGGATC AGTACAAGGC AGGAGCTGCA TCAAACGCCC ATGTTGCGCA ACATTGACTT 
0181 CCAGAGGGTG CTCGAGAAGA AGATCAAACC CATCTATAAA CCTCCCGAAG ACCACCTCAA 
0241 CTGTGATCCT TGCCTAGAAC TGGAGGAAAT GATTGTAGAA TCGCGGCCCT TGCATAAAAA 
0301 GAAGAAGCGC CTGGCCAAGC AGAGGTCAGC ACAACGCGAC AGCGATCCAG AAGGACTGCA 
0361 CTGGTCAAAG AGTTCATCGT TTACAACCGC TACAAGGAGT TGAAGCGNAA AGCCATGGAA 
0421 CAAAAGGAAA ACGACTGGCA GCGCGAACTG GNAACTGGCC ATGGCCAACT CCATCGTGAA 
0481 CAGCTTGGCC CCCATCCAAG AGA 
 in silico PCR Fragment
0001 GCACTCGAAC ACCCCACTAG CGGAGATCAA GAATATATTG AACACCCCCG TGCACTATCC 
0061 GCGCTACTGG AGCAGCAACT TCGTCGATCT GCTGCAGAGG TTACTTTCCA CCTATCCGGG 
0121 TGCTAGGATC AGTACAAGGC AGGAGCTGCA TCAAACGCCC ATGTTGCGCA ACATTGACTT 
0181 CCAGAGGGTG CTCGAGAAGA AGATCAAACC CATCTATAAA CCTCCCGAAG ACCACCTCAA 
0241 CTGTGATCCT TGCCTAGAAC TGGAGGAAAT GATTGTAGAA TCGCGGCCCT TGCATAAAAA 
0301 GAAGAAGCGC CTGGCCAAGC AGAGGTCAGC ACAACGCGAC AGCGATCCAG A--GACTGCA 
0361 CTGGTCAAAG AGTTCATCGT TTACAACCGC TACAAGGAGT TGAAGCGCAA AGCCATGGAA 
0421 CAAAAGGAAA ACGACTGGCA GCGCGAACTG G-AACTGGCC ATGGCCAACT CCATCGTGAA 
0481 CAGCTTGGCC CCCATCCAAG AGA 
 Assemble Data

10532R-1.IR_full       1   GCACTCGAACACCCCACTAGCGGAGATCAAGAATATATTGAACACCCCCGTGCACTATCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10532R-1.in silico     1   GCACTCGAACACCCCACTAGCGGAGATCAAGAATATATTGAACACCCCCGTGCACTATCC 60


10532R-1.IR_full       61  GCGCTACTGGAGCAGCAACTTCGTCGATCTGCTGCAGAGGTTACTTTCCACCTATCCGGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10532R-1.in silico     61  GCGCTACTGGAGCAGCAACTTCGTCGATCTGCTGCAGAGGTTACTTTCCACCTATCCGGG 120


10532R-1.IR_full       121 TGCTAGGATCAGTACAAGGCAGGAGCTGCATCAAACGCCCATGTTGCGCAACATTGACTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10532R-1.in silico     121 TGCTAGGATCAGTACAAGGCAGGAGCTGCATCAAACGCCCATGTTGCGCAACATTGACTT 180


10532R-1.IR_full       181 CCAGAGGGTGCTCGAGAAGAAGATCAAACCCATCTATAAACCTCCCGAAGACCACCTCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10532R-1.in silico     181 CCAGAGGGTGCTCGAGAAGAAGATCAAACCCATCTATAAACCTCCCGAAGACCACCTCAA 240


10532R-1.IR_full       241 CTGTGATCCTTGCCTAGAACTGGAGGAAATGATTGTAGAATCGCGGCCCTTGCATAAAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10532R-1.in silico     241 CTGTGATCCTTGCCTAGAACTGGAGGAAATGATTGTAGAATCGCGGCCCTTGCATAAAAA 300


10532R-1.IR_full       301 GAAGAAGCGCCTGGCCAAGCAGAGGTCAGCACAACGCGACAGCGATCCAGAAGGACTGCA 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
10532R-1.in silico     301 GAAGAAGCGCCTGGCCAAGCAGAGGTCAGCACAACGCGACAGCGATCCAGA--GACTGCA 360


10532R-1.IR_full       361 CTGGTCAAAGAGTTCATCGTTTACAACCGCTACAAGGAGTTGAAGCGNAAAGCCATGGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10532R-1.in silico     361 CTGGTCAAAGAGTTCATCGTTTACAACCGCTACAAGGAGTTGAAGCGCAAAGCCATGGAA 420


10532R-1.IR_full       421 CAAAAGGAAAACGACTGGCAGCGCGAACTGGNAACTGGCCATGGCCAACTCCATCGTGAA 480
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
10532R-1.in silico     421 CAAAAGGAAAACGACTGGCAGCGCGAACTGG-AACTGGCCATGGCCAACTCCATCGTGAA 480


10532R-1.IR_full       481 CAGCTTGGCCCCCATCCAAGAGA 503
                           |||||||||||||||||||||||
10532R-1.in silico     481 CAGCTTGGCCCCCATCCAAGAGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_001043201.1  CG32944-RC, transcript variant C (CG32944), mRNA 
100   482  12  NM_176397.2  CG32944-RB, transcript variant B (CG32944), mRNA 
0.2   NM_079859.2  CG1438-RA (Cyp4c3), mRNA 
0   NM_132642.2  CG15744-RA (CG15744), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_136755.2  CG16728-RA (CG16728), mRNA 
0   NM_078740.2  CG8817-RB, transcript variant B (lilli), mRNA 
0   NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   NM_164517.1  CG8817-RC, transcript variant C (lilli), mRNA 
0   NM_141291.2  CG10018-RA (Snm1), mRNA 
0   NM_141226.2  CG1057-RA, transcript variant A (MED31), mRNA 
0   NM_169013.1  CG1057-RB, transcript variant B (MED31), mRNA 
0   NM_142774.2  CG18596-RA (CG18596), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_078592.2  CG11172-RA (NFAT), mRNA 
0   NM_135824.2  CG9014-RA (CG9014), mRNA 
0   NM_078672.3  CG7113-RA (scu), mRNA 
0   NM_166823.1  CG11059-RB, transcript variant B (cals), mRNA 
0   NM_079893.2  CG11059-RA, transcript variant A (cals), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_168781.1  CG3961-RA, transcript variant A (CG3961), mRNA 
0   NM_140810.2  CG3961-RC, transcript variant C (CG3961), mRNA 
0   NM_168782.1  CG3961-RB, transcript variant B (CG3961), mRNA 
0   NM_079823.2  CG1395-RA (stg), mRNA 
0   NM_079992.3  CG17976-RA (sut3), mRNA 
0   NM_142954.3  CG6057-RA (SMC1), mRNA 
0   NM_137978.1  CG18128-RA (CG18128), mRNA 
0   NM_136402.2  CG9460-RA (CG9460), mRNA 
0   NM_079059.2  CG5519-RA (Gbp), mRNA 
0   NM_132420.2  CG32676-RA (CG32676), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.