National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10522R-1 
 Symbol sti  Full Name sticky 
 CG No CG10522  Old CG No CG10522 
 Synonyms CG10522, dck, cit, l(3)7m62, l(3)7m-62, l(3)SG21, anon-WO0118547.388, sti 
 Accession No (Link to NCBI) NM_140327.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tran THY, Yang DW, Kim M, Lee DH, Gai M, Di Cunto F, Choi KW, Lim DS.
Citron kinase interacts with LATS2 and inhibits its activity by occluding its hydrophobic phosphorylation motif.
J Mol Cell Biol (2019) 11(11) 1006-1017 [ PubMed ID = 30865227 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCCAAGATGGAGCCGATTA 
 Primer Seq. 3'
aatctagaggtaccCCATTCAGAGTTGCGAATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCCAAGAT GGAGCCGATT ANGCGTGcGN ACCGCGCGTN CTGAACAACC TGATTCTGGG 
0061 CAAAGGAGCT GGCGTCTGTG CNGAAGCNCG CTGGAAGCGc CTNCCGGATC AGGTATTCCC 
0121 GCCTCCACCA GGAGNAAGCA TTGTACCCGT GAGCACCACT AGCGCCGCCG TgGCCGAGGC 
0181 CATCNTGCCG CGAGGGACTC CTGGACGCCT TCTGTCTGCT GTACAACGAG TGCGACAAGG 
0241 ATACGCTGAA GANAGCGCGA TCGCAACATC GCCGAGTTTG TCAACAAATT TCGTCCCATC 
0301 ATAGAGGAGA CCCGCAAACT CAGGGTCAAC GCAGATGACT TCCTCATCAA GACGCTTATT 
0361 GGCCAAGGAT ACTTTGGCAA CGTTCACCTG GTGGTGGAGC GGCAAACCAA CGACATATAC 
0421 GCCATGAAGA AGATCAAAAA GTCGGTGGTG ACGACGTCAC AAGTCAAGGA GGAGCGCGAT 
0481 ATCATGTCCA TTCGCAACTC TGAATGG 
 in silico PCR Fragment
0001 CACCCAAGAT GGAGCCGATT A-GCGTGCGC ACCGCGCGT- CTGAACAACC TGATTCTGGG 
0061 CAAAGGAGCT GGCGTCTGTG -CGAAGCCCG CTGGAAGCGC CT-CCGGATC AGGTATTCCC 
0121 GCCTCCACCA GGAG-AAGCA TTGTACCCGT GAGCACCACT AGCGCCGCCG TGGCCGAGGC 
0181 CATC-TGCCG CGAGGGACTC CTGGACGCCT TCTGTCTGCT GTACAACGAG TGCGACAAGG 
0241 ATACGCTGAA GA-AGCGCGA TCGCAACATC GCCGAGTTTG TCAACAAATT TCGTCCCATC 
0301 ATAGAGGAGA CCCGCAAACT CAGGGTCAAC GCAGATGACT TCCTCATCAA GACGCTTATT 
0361 GGCCAAGGAT ACTTTGGCAA CGTTCACCTG GTGGTGGAGC GGCAAACCAA CGACATATAC 
0421 GCCATGAAGA AGATCAAAAA GTCGGTGGTG ACGACGTCAC AAGTCAAGGA GGAGCGCGAT 
0481 ATCATGTCCA TTCGCAACTC TGAATGG 
 Assemble Data

10522R-1.IR_full       1   CACCCAAGATGGAGCCGATTANGCGTGCGNACCGCGCGTNCTGAACAACCTGATTCTGGG 60
                           ||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||
10522R-1.in silico     1   CACCCAAGATGGAGCCGATTA-GCGTGCGCACCGCGCGT-CTGAACAACCTGATTCTGGG 60


10522R-1.IR_full       61  CAAAGGAGCTGGCGTCTGTGCNGAAGCNCGCTGGAAGCGCCTNCCGGATCAGGTATTCCC 120
                           ||||||||||||||||||||  ||||| |||||||||||||| |||||||||||||||||
10522R-1.in silico     61  CAAAGGAGCTGGCGTCTGTG-CGAAGCCCGCTGGAAGCGCCT-CCGGATCAGGTATTCCC 120


10522R-1.IR_full       121 GCCTCCACCAGGAGNAAGCATTGTACCCGTGAGCACCACTAGCGCCGCCGTGGCCGAGGC 180
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     121 GCCTCCACCAGGAG-AAGCATTGTACCCGTGAGCACCACTAGCGCCGCCGTGGCCGAGGC 180


10522R-1.IR_full       181 CATCNTGCCGCGAGGGACTCCTGGACGCCTTCTGTCTGCTGTACAACGAGTGCGACAAGG 240
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     181 CATC-TGCCGCGAGGGACTCCTGGACGCCTTCTGTCTGCTGTACAACGAGTGCGACAAGG 240


10522R-1.IR_full       241 ATACGCTGAAGANAGCGCGATCGCAACATCGCCGAGTTTGTCAACAAATTTCGTCCCATC 300
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     241 ATACGCTGAAGA-AGCGCGATCGCAACATCGCCGAGTTTGTCAACAAATTTCGTCCCATC 300


10522R-1.IR_full       301 ATAGAGGAGACCCGCAAACTCAGGGTCAACGCAGATGACTTCCTCATCAAGACGCTTATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     301 ATAGAGGAGACCCGCAAACTCAGGGTCAACGCAGATGACTTCCTCATCAAGACGCTTATT 360


10522R-1.IR_full       361 GGCCAAGGATACTTTGGCAACGTTCACCTGGTGGTGGAGCGGCAAACCAACGACATATAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     361 GGCCAAGGATACTTTGGCAACGTTCACCTGGTGGTGGAGCGGCAAACCAACGACATATAC 420


10522R-1.IR_full       421 GCCATGAAGAAGATCAAAAAGTCGGTGGTGACGACGTCACAAGTCAAGGAGGAGCGCGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10522R-1.in silico     421 GCCATGAAGAAGATCAAAAAGTCGGTGGTGACGACGTCACAAGTCAAGGAGGAGCGCGAT 480


10522R-1.IR_full       481 ATCATGTCCATTCGCAACTCTGAATGG 507
                           |||||||||||||||||||||||||||
10522R-1.in silico     481 ATCATGTCCATTCGCAACTCTGAATGG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140327.1  CG10522-RA (sti), mRNA 
0.41   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_133098.2  CG7053-RA (CG7053), mRNA 
0   NM_144367.1  CG6633-RA (Ugt86Dd), mRNA 
0   NM_001042995.1  CG12547-RA (CG12547), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_079325.2  CG5433-RA (Klc), mRNA 
0   NM_143722.2  CG4913-RA (ear), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_078664.2  CG5870-RA (beta-Spec), mRNA 
0   NM_134584.2  CG32512-RA (CG32512), mRNA 
0   NM_168452.1  CG6199-RB, transcript variant B (CG6199), mRNA 
0   NM_140194.1  CG6199-RA, transcript variant A (CG6199), mRNA 
0   NM_164453.3  CG7254-RA, transcript variant A (GlyP), mRNA 
0   NM_001032048.1  CG7254-RB, transcript variant B (GlyP), mRNA 
0   NM_168360.1  CG6767-RB, transcript variant B (CG6767), mRNA 
0   NM_140088.2  CG6767-RA, transcript variant A (CG6767), mRNA 
0   NM_079959.2  CG4501-RA (bgm), mRNA 
0   NM_165018.1  CG6167-RB, transcript variant B (PICK1), mRNA 
0   NM_135738.2  CG6167-RA, transcript variant A (PICK1), mRNA 
0   NM_134811.2  CG10880-RA (CG10880), mRNA 
0   NM_142590.1  CG4465-RA (CG4465), mRNA 
0   NM_136176.2  CG13969-RA (bwa), mRNA 
0   NM_138216.1  CG13886-RA (CG13886), mRNA 
0   NM_168650.1  CG5284-RA, transcript variant A (CG5284), mRNA 
0   NM_140577.1  CG5284-RB, transcript variant B (CG5284), mRNA 
0   15  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   15  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   15  NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   15  NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
+- 
VM
+- 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.