National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10520R-3 
 Symbol tub  Full Name tube 
 CG No CG10520  Old CG No CG10520 
 Synonyms CG10520, tub, tube 
 Accession No (Link to NCBI) NM_168992.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wu C, Chen Y, Wang F, Chen C, Zhang S, Li C, Li W, Wu S, Xue L.
Pelle Modulates dFoxO-Mediated Cell Death in Drosophila.
PLoS Genet. (2015) 11(10) e1005589 [ PubMed ID = 26474173 ] [ RRC reference ]

Wu C, Chen C, Dai J, Zhang F, Chen Y, Li W, Pastor-Pareja JC, Xue L.
Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila.
Open Biol (2015) 5(7) 140171 [ PubMed ID = 26202785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACGGCGCCATAGGTTTATC 
 Primer Seq. 3'
aatctagaggtaccCCTCGTTGTCCACTTCCATTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAACGGCGCC ATAGGTTTNT CCTCGAAGTA TTCTCGCNAC ACGGAGCTGC GACgNGTTGA 
0061 GGACAATGAC ATTTACCGGC TTGcCAAAAT ACTAGATGAG AACTCATGCT GGCGCAAATT 
0121 GATGTCGATC ATACCCAAGG GCATGGATGT GCAGGCCTGC AGCGGAGCCG GATGCTTGAA 
0181 TTTTCCGGCG GAAATCAAAA AGGGATTTAA GTACACTGCG CAGGACGTGT TCCAGATTGA 
0241 CGAGGCTGCA AACCGACTAC CGCCGGACCA AAGCAAGTCG CAGATGATGA TCGACGAGTG 
0301 GAAGACCTCT GGCAAGCTCA ACGAGCGGCC CACGGTTGGG GTATTGCTCC AACTTCTGGT 
0361 GCAGGCAGAG CTCTTCAGTG CGGCAGACTT TGTGGCACTA GACTTCCTAA ATGAGTCCAC 
0421 CCCTGCCCGG CCTGTTGACG GGTCCCGGTG CGCTCATAAG CCTTGAGCTG CTGGAAGAGG 
0481 AAATGGAAGT GGACAACGAG G 
 in silico PCR Fragment
0001 CAACGGCGCC ATAGGTTTAT CCTCGAAGTA TTCTCGCAAC ACGGAGCTGC GACGCGTTGA 
0061 GGACAATGAC ATTTACCGGC TTGCCAAAAT ACTAGATGAG AACTCATGCT GGCGCAAATT 
0121 GATGTCGATC ATACCCAAGG GCATGGATGT GCAGGCCTGC AGCGGAGCCG GATGCTTGAA 
0181 TTTTCCGGCG GAAATCAAAA AGGGATTTAA GTACACTGCG CAGGACGTGT TCCAGATTGA 
0241 CGAGGCTGCA AACCGACTAC CGCCGGACCA AAGCAAGTCG CAGATGATGA TCGACGAGTG 
0301 GAAGACCTCT GGCAAGCTCA ACGAGCGGCC CACGGTTGGG GTATTGCTCC AACTTCTGGT 
0361 GCAGGCAGAG CTCTTCAGTG CGGCAGACTT TGTGGCACTA GACTTCCTAA ATGAGTCCAC 
0421 CCCTGCCCGG CCTGTTGAC- GGTCCCGGTG CGCTCATAAG CCTTGAGCTG CTGGAAGAGG 
0481 AAATGGAAGT GGACAACGAG G 
 Assemble Data

10520R-3.IR_full       1   CAACGGCGCCATAGGTTTNTCCTCGAAGTATTCTCGCNACACGGAGCTGCGACGNGTTGA 60
                           |||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||
10520R-3.in silico     1   CAACGGCGCCATAGGTTTATCCTCGAAGTATTCTCGCAACACGGAGCTGCGACGCGTTGA 60


10520R-3.IR_full       61  GGACAATGACATTTACCGGCTTGCCAAAATACTAGATGAGAACTCATGCTGGCGCAAATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     61  GGACAATGACATTTACCGGCTTGCCAAAATACTAGATGAGAACTCATGCTGGCGCAAATT 120


10520R-3.IR_full       121 GATGTCGATCATACCCAAGGGCATGGATGTGCAGGCCTGCAGCGGAGCCGGATGCTTGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     121 GATGTCGATCATACCCAAGGGCATGGATGTGCAGGCCTGCAGCGGAGCCGGATGCTTGAA 180


10520R-3.IR_full       181 TTTTCCGGCGGAAATCAAAAAGGGATTTAAGTACACTGCGCAGGACGTGTTCCAGATTGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     181 TTTTCCGGCGGAAATCAAAAAGGGATTTAAGTACACTGCGCAGGACGTGTTCCAGATTGA 240


10520R-3.IR_full       241 CGAGGCTGCAAACCGACTACCGCCGGACCAAAGCAAGTCGCAGATGATGATCGACGAGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     241 CGAGGCTGCAAACCGACTACCGCCGGACCAAAGCAAGTCGCAGATGATGATCGACGAGTG 300


10520R-3.IR_full       301 GAAGACCTCTGGCAAGCTCAACGAGCGGCCCACGGTTGGGGTATTGCTCCAACTTCTGGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     301 GAAGACCTCTGGCAAGCTCAACGAGCGGCCCACGGTTGGGGTATTGCTCCAACTTCTGGT 360


10520R-3.IR_full       361 GCAGGCAGAGCTCTTCAGTGCGGCAGACTTTGTGGCACTAGACTTCCTAAATGAGTCCAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     361 GCAGGCAGAGCTCTTCAGTGCGGCAGACTTTGTGGCACTAGACTTCCTAAATGAGTCCAC 420


10520R-3.IR_full       421 CCCTGCCCGGCCTGTTGACGGGTCCCGGTGCGCTCATAAGCCTTGAGCTGCTGGAAGAGG 480
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
10520R-3.in silico     421 CCCTGCCCGGCCTGTTGAC-GGTCCCGGTGCGCTCATAAGCCTTGAGCTGCTGGAAGAGG 480


10520R-3.IR_full       481 AAATGGAAGTGGACAACGAGG 501
                           |||||||||||||||||||||
10520R-3.in silico     481 AAATGGAAGTGGACAACGAGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168992.2  CG10520-RA (tub), mRNA 
0   NM_079054.3  CG6493-RA (Dcr-2), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_080138.2  CG1618-RA (comt), mRNA 
0   NM_136195.2  CG15475-RA (CG15475), mRNA 
0   11  NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_137204.3  CG12963-RA, transcript variant A (CG12963), mRNA 
0   NM_080142.2  CG1925-RA (mus205), mRNA 
0   NM_137031.2  CG4840-RA (CG4840), mRNA 
0   NM_164670.1  CG9075-RD, transcript variant D (eIF-4a), mRNA 
0   NM_164669.1  CG9075-RB, transcript variant B (eIF-4a), mRNA 
0   NM_057247.3  CG9075-RC, transcript variant C (eIF-4a), mRNA 
0   NM_164668.1  CG9075-RA, transcript variant A (eIF-4a), mRNA 
0   NM_001014713.1  CG9075-RA, transcript variant A (eIF-4a), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
0   NM_080294.3  CG9075-RA, transcript variant A (eIF-4a), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
0   NM_132164.1  CG18155-RA, transcript variant A (CG18155), mRNA 
0   NM_206637.1  CG18155-RB, transcript variant B (CG18155), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_140830.1  CG14080-RB, transcript variant B (Mkp3), mRNA 
0   NM_137611.1  CG16894-RA (CG16894), mRNA 
0   NM_142242.2  CG9597-RA (CG9597), mRNA 
0   NM_057470.3  CG9191-RA (Klp61F), mRNA 
0   NM_176360.1  CG32206-RC, transcript variant C (CG32206), mRNA 
0   NM_168794.2  CG32206-RB, transcript variant B (CG32206), mRNA 
0   NM_165375.2  CG31623-RA (dtr), mRNA 
0   NM_167848.1  CG18214-RD, transcript variant D (trio), mRNA 
0   NM_167849.1  CG18214-RB, transcript variant B (trio), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.