National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10509R-1 
 Symbol CG30390  Full Name CG30390 
 CG No CG30390  Old CG No CG10509 
 Synonyms CG10509, CG30390 
 Accession No (Link to NCBI) NM_166436.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Mahesh G, Rivas GBS, Caster C, Ost EB, Amunugama R, Jones R, Allen DL, Hardin PE.
Proteomic analysis of Drosophila CLOCK complexes identifies rhythmic interactions with SAGA and Tip60 complex component NIPPED-A.
Sci Rep (2020) 10(1) 17951 [ PubMed ID = 33087840 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCACTGACTGCGGAGAGT 
 Primer Seq. 3'
aatctagaggtaccTGCACCACTTCCGCCAGGATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCCACTGA CTGCGGAGAG TGCCGCCCAA CAGATTCAGG ATCGCCTAAA GGACATTCAA 
0061 CAAAACATTC ACAATGTGGA CGAGGAGCGT CGTCGTGCGG AAAACTCCAT TGCTAGTCTG 
0121 GTGCGATCTC TGCATGCCAC CAATCAGAAG GTTAAGCCCC TGCTTAAGGC CAGTTTAACG 
0181 GAGGCTGCGC AGGAGGAGGC CACAATCCGA GTCGCACTGG CCAAAATCCA CGAGATTCGA 
0241 AGCATTCGCA ACGAGAGGCG CATCCAAGCT CGCAACGCTG GAAATAAGGA GGCCATTCGA 
0301 CGGGGCGCCC TTATGAAAAT GGTGCAGCTC TCAGCGCAAA CGTTGCCTTT GTTCGTTGGC 
0361 AAACTAGGAG AACGAGCACC AGCTCTATGT GGAGCCATTC CCGCCGAGGG GAACTATGTG 
0421 GCCAAGGTTG GCGACAATGT TGCCGCATTA GCTAAGGGAA TTGATGAGGA GGAGAACTGG 
0481 ATCCTGGCGG AAGTGGTGCA  
 in silico PCR Fragment
0001 ATGCCACTGA CTGCGGAGAG TGCCGCCCAA CAGATTCAGG ATCGCCTGAA GGACATTCAA 
0061 CAAAACATTC ACAATGTGGA CGAGGAGCGT CGTCGTGCGG AAAACTCCAT TGCTAGTCTG 
0121 GTGCGATCTC TGCACGCCAC CAATCAGAAG GTTAAGCCCC TGCTCAAGGC CAGTTTAACG 
0181 GAGGCTGCGC AGGAGGAGGC CACAATCCGA GCCGCACTGG CGAAAATCCA CGAGATTCGA 
0241 AGCATTCGCA ATGAGAGGCG CATCCAAGCT CGCAACGCTG GAAATAAGGA GGCCATTCGA 
0301 CGGGGCGCCC TTATGAAAAT GGTGCAGCTC TCAGCGCAAA CGTTGCCGTT ATTCGTTGGC 
0361 AAACTAGGAG AACGAGCACC AGCTCTATGT GGAGCCATTC CCGCCGAGGG GAACTATGTG 
0421 GCCAAGGTTG GCGACAATGT TGCCGCATTA GCTAAGGGAA TTGATGAGGA GGAGAACTGG 
0481 ATCCTGGCGG AAGTGGTGCA  
 Assemble Data

10509R-1.IR_full       1   ATGCCACTGACTGCGGAGAGTGCCGCCCAACAGATTCAGGATCGCCTAAAGGACATTCAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10509R-1.in silico     1   ATGCCACTGACTGCGGAGAGTGCCGCCCAACAGATTCAGGATCGCCTGAAGGACATTCAA 60


10509R-1.IR_full       61  CAAAACATTCACAATGTGGACGAGGAGCGTCGTCGTGCGGAAAACTCCATTGCTAGTCTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10509R-1.in silico     61  CAAAACATTCACAATGTGGACGAGGAGCGTCGTCGTGCGGAAAACTCCATTGCTAGTCTG 120


10509R-1.IR_full       121 GTGCGATCTCTGCATGCCACCAATCAGAAGGTTAAGCCCCTGCTTAAGGCCAGTTTAACG 180
                           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
10509R-1.in silico     121 GTGCGATCTCTGCACGCCACCAATCAGAAGGTTAAGCCCCTGCTCAAGGCCAGTTTAACG 180


10509R-1.IR_full       181 GAGGCTGCGCAGGAGGAGGCCACAATCCGAGTCGCACTGGCCAAAATCCACGAGATTCGA 240
                           ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||
10509R-1.in silico     181 GAGGCTGCGCAGGAGGAGGCCACAATCCGAGCCGCACTGGCGAAAATCCACGAGATTCGA 240


10509R-1.IR_full       241 AGCATTCGCAACGAGAGGCGCATCCAAGCTCGCAACGCTGGAAATAAGGAGGCCATTCGA 300
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
10509R-1.in silico     241 AGCATTCGCAATGAGAGGCGCATCCAAGCTCGCAACGCTGGAAATAAGGAGGCCATTCGA 300


10509R-1.IR_full       301 CGGGGCGCCCTTATGAAAATGGTGCAGCTCTCAGCGCAAACGTTGCCTTTGTTCGTTGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||
10509R-1.in silico     301 CGGGGCGCCCTTATGAAAATGGTGCAGCTCTCAGCGCAAACGTTGCCGTTATTCGTTGGC 360


10509R-1.IR_full       361 AAACTAGGAGAACGAGCACCAGCTCTATGTGGAGCCATTCCCGCCGAGGGGAACTATGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10509R-1.in silico     361 AAACTAGGAGAACGAGCACCAGCTCTATGTGGAGCCATTCCCGCCGAGGGGAACTATGTG 420


10509R-1.IR_full       421 GCCAAGGTTGGCGACAATGTTGCCGCATTAGCTAAGGGAATTGATGAGGAGGAGAACTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10509R-1.in silico     421 GCCAAGGTTGGCGACAATGTTGCCGCATTAGCTAAGGGAATTGATGAGGAGGAGAACTGG 480


10509R-1.IR_full       481 ATCCTGGCGGAAGTGGTGCA 500
                           ||||||||||||||||||||
10509R-1.in silico     481 ATCCTGGCGGAAGTGGTGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166436.1  CG30390-RA (CG30390), mRNA 
0   NM_079295.2  CG6539-RA (Dhh1), mRNA 
0   NM_136835.2  CG9035-RA (Tapdelta), mRNA 
0   NM_136764.2  CG12340-RA (CG12340), mRNA 
0   NM_176103.1  CG14764-RA (CG14764), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_132186.1  CG10932-RA (CG10932), mRNA 
0   NM_165933.1  CG8632-RB, transcript variant B (CG8632), mRNA 
0   NM_136962.2  CG8632-RA, transcript variant A (CG8632), mRNA 
0   NM_176383.2  CG10508-RE, transcript variant E (CG10508), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_168724.1  CG6445-RB, transcript variant B (Cad74A), mRNA 
0   NM_140716.1  CG6445-RA, transcript variant A (Cad74A), mRNA 
0   NM_135034.1  CG15624-RA, transcript variant A (hoe2), mRNA 
0   NM_139574.2  CG32262-RA (CG32262), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.