National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10505R-3 
 Symbol CG10505  Full Name CG10505 
 CG No CG10505  Old CG No CG10505 
 Synonyms Dme_CG10505, CG10505 
 Accession No (Link to NCBI) NM_137727.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACCTACAGCCCCACTGGGA 
 Primer Seq. 3'
aatctagaggtaccGGCGGGTCATCAAGTAGCCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAACCTACAG CCCCACTGGG AGAAGGAGTC CAAGAAGAAA AATCCGAGTC TTATGCGGCT 
0061 GATCTTTAAG GTCTACGGAT GGCAGTTTGT TCCCGTTTGC ATTTTATATT CTCTGTTGGA 
0121 AATGGCTATT CATTCCTTCC AGCCTTNGCT GCTCGGAGGA TTGATCTCCT ACTTCGCCTA 
0181 CGGCCAGACG ACGGTGACCA AGGAGAGTGC CTATCTGTAC GCCATGGGCA TTGTCCTGTG 
0241 CTCGCTGGTC ACCTCCCTAG TGTTTCACCC ATTTATGTTC TACGTATTCG CGGTGGGAAC 
0301 GCGGGTCAGA TTGGCCTGTG CCGGCCTGGT CTACCGGAAA TGTCTGCGCG CCTCGGCGAG 
0361 CAGTGGCGAA GGACTTGGAG GCCAGGCCAT TTCGGTGATG TCCATCGATC TCTCGCAATT 
0421 CGACTTGACT TTCTACTTCT TTCACGACCT GTGGAAGGGT CCCGTGGAGG CCTGTATCTT 
0481 TGGCTACTTG ATGANCCGNC  
 in silico PCR Fragment
0001 AAACCTACAG CCCCACTGGG AGAAGGAGTC CAAGAAGAAA AATCCGAGTC TTATGCGGCT 
0061 GATCTTTAAG GTCTACGGAT GGCAGTTTGT TCCCGTTTGC ATTTTATATT CTCTGTTGGA 
0121 AATGGCTATT CATTCCTTCC AGCCTTTGCT GCTCGGAGGA TTGATCTCCT ACTTCGCCTA 
0181 CGGCCAGACG ACGGTGACCA AGGAGAGTGC CTATCTGTAC GCCATGGGCA TTGTCCTGTG 
0241 CTCGCTGGTC ACCTCCCTAG TGTTTCACCC ATTTATGTTC TACGTATTCG CGGTGGGAAC 
0301 GCGGGTCAGA TTGGCCTGTG CCGGCCTGGT CTACCGGAAA TGTCTGCGCG CCTCGGCGAG 
0361 CAGTGGCGAA GGACTTGGAG GCCAGGCCAT TTCGGTGATG TCCATCGATC TCTCGCAGTT 
0421 CGACTTGACT TTTTACTTCT TTCACGACCT GTGGAAGGGT CCCGTGGAGG CCTGTATCTT 
0481 TGGCTACTTG ATGACCCGCC  
 Assemble Data

10505R-3.IR_full       1   AAACCTACAGCCCCACTGGGAGAAGGAGTCCAAGAAGAAAAATCCGAGTCTTATGCGGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     1   AAACCTACAGCCCCACTGGGAGAAGGAGTCCAAGAAGAAAAATCCGAGTCTTATGCGGCT 60


10505R-3.IR_full       61  GATCTTTAAGGTCTACGGATGGCAGTTTGTTCCCGTTTGCATTTTATATTCTCTGTTGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     61  GATCTTTAAGGTCTACGGATGGCAGTTTGTTCCCGTTTGCATTTTATATTCTCTGTTGGA 120


10505R-3.IR_full       121 AATGGCTATTCATTCCTTCCAGCCTTNGCTGCTCGGAGGATTGATCTCCTACTTCGCCTA 180
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
10505R-3.in silico     121 AATGGCTATTCATTCCTTCCAGCCTTTGCTGCTCGGAGGATTGATCTCCTACTTCGCCTA 180


10505R-3.IR_full       181 CGGCCAGACGACGGTGACCAAGGAGAGTGCCTATCTGTACGCCATGGGCATTGTCCTGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     181 CGGCCAGACGACGGTGACCAAGGAGAGTGCCTATCTGTACGCCATGGGCATTGTCCTGTG 240


10505R-3.IR_full       241 CTCGCTGGTCACCTCCCTAGTGTTTCACCCATTTATGTTCTACGTATTCGCGGTGGGAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     241 CTCGCTGGTCACCTCCCTAGTGTTTCACCCATTTATGTTCTACGTATTCGCGGTGGGAAC 300


10505R-3.IR_full       301 GCGGGTCAGATTGGCCTGTGCCGGCCTGGTCTACCGGAAATGTCTGCGCGCCTCGGCGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     301 GCGGGTCAGATTGGCCTGTGCCGGCCTGGTCTACCGGAAATGTCTGCGCGCCTCGGCGAG 360


10505R-3.IR_full       361 CAGTGGCGAAGGACTTGGAGGCCAGGCCATTTCGGTGATGTCCATCGATCTCTCGCAATT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
10505R-3.in silico     361 CAGTGGCGAAGGACTTGGAGGCCAGGCCATTTCGGTGATGTCCATCGATCTCTCGCAGTT 420


10505R-3.IR_full       421 CGACTTGACTTTCTACTTCTTTCACGACCTGTGGAAGGGTCCCGTGGAGGCCTGTATCTT 480
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
10505R-3.in silico     421 CGACTTGACTTTTTACTTCTTTCACGACCTGTGGAAGGGTCCCGTGGAGGCCTGTATCTT 480


10505R-3.IR_full       481 TGGCTACTTGATGANCCGNC 500
                           |||||||||||||| ||| |
10505R-3.in silico     481 TGGCTACTTGATGACCCGCC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137727.1  CG10505-RA (CG10505), mRNA 
0.2   NM_167268.1  CG1453-RC, transcript variant C (Klp10A), mRNA 
0.2   NM_167267.1  CG1453-RB, transcript variant B (Klp10A), mRNA 
0.2   NM_167269.1  CG1453-RD, transcript variant D (Klp10A), mRNA 
0.2   NM_132459.2  CG1453-RA, transcript variant A (Klp10A), mRNA 
0.2   NM_167270.1  CG1453-RE, transcript variant E (Klp10A), mRNA 
0   NM_079597.2  CG14716-RA (Ho), mRNA 
0   NM_140181.1  CG12522-RA (CG12522), mRNA 
0   NM_080534.3  CG7230-RA (rib), mRNA 
0   NM_133102.1  CG7274-RA (CG7274), mRNA 
0   NM_144447.1  CG18870-RA (CG18870), mRNA 
0   NM_176136.3  CG12052-RK, transcript variant K (lola), mRNA 
0   NM_141660.2  CG9424-RA, transcript variant A (bocksbeutel), mRNA 
0   NM_001014611.1  CG9424-RB, transcript variant B (bocksbeutel), mRNA 
0   NM_001043139.1  CG11282-RC, transcript variant C (caps), mRNA 
0   NM_079685.2  CG4451-RA (Hs6st), mRNA 
0   NM_168540.1  CG11282-RB, transcript variant B (caps), mRNA 
0   NM_079332.2  CG11282-RA, transcript variant A (caps), mRNA 
0   NM_140767.1  CG5485-RA (Prestin), mRNA 
0   NM_176232.1  CG15097-RB, transcript variant B (CG15097), mRNA 
0   NM_137533.3  CG15097-RA, transcript variant A (CG15097), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_138157.2  CG7051-RB, transcript variant B (CG7051), mRNA 
0   NM_167796.2  CG7051-RA, transcript variant A (CG7051), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_170171.1  CG31357-RA (CG31357), mRNA 
0   NM_134500.2  CG14224-RA (CG14224), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.