National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10498R-2 
 Symbol cdc2c  Full Name cdc2c 
 CG No CG10498  Old CG No CG10498 
 Synonyms Cdk2, cdk2, CDK2, Cdc2c, CG10498, CDK2/CDC2c, S(Sev-CycE)3A, DmCdk2, Dmcdc2c, DmCdc2, Dcdc2c, CDC2c, cdc2c 
 Accession No (Link to NCBI) NM_169916.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Hosono C, Matsuda R, Adryan B, Samakovlis C.
Transient junction anisotropies orient annular cell polarization in the Drosophila airway tubes.
Nat. Cell Biol. (2015) 17(12) 1569-76 [ PubMed ID = 26551273 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0481 TGG 
 in silico PCR Fragment
0481 TGG 
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCGCCGAAAAGATTGGCGAGGGCACCTACGGTATAGTTTACAAAGCGCGTAGCAACTCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCGGCCAGGATGTGGCCCTCAAAAAGATTCGGCTAGAAGGCGAAACGGAGGGTGTTCCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCGACGGCCATTCGAGAGATCTCCCTGCTGAAGAACCTTAAGCACCCAAATGTGGTCCAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTATTTGACGTAGTCATTTCCGGCAACAATCTGTACATGATATTCGAGTACCTGAACATG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATCTAAAGAAGCTGATGGATAAGAAAAAAGACGTGTTCACCCCTCAGTTGATAAAGAGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATATGCATCAGATATTAGATGCCGTCGGCTTTTGCCACACGAATCGTATCCTGCATCGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATCTCAAGCCCCAGAACCTTCTCGTAGACACGGCGGGCAAAATAAAGTTGGCTGACTTT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCCTAGCAAGGGCCTTCAACGTGCCTATGCGGGCGTACACACACGAAGTCGTCACCCTC 480

10498R-2.IR_full       481 TGG 483
                           ||| silico     481 TGG 483

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   465  NM_079696.4  CG10498-RB, transcript variant B (cdc2c), mRNA 
100   465  NM_169916.1  CG10498-RA, transcript variant A (cdc2c), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_057449.3  CG5363-RA (cdc2), mRNA 
0   NM_143454.1  CG7584-RA (Obp99c), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_176688.1  CG3086-RD, transcript variant D (MAPk-Ak2), mRNA 
0   NM_080030.3  CG3086-RB, transcript variant B (MAPk-Ak2), mRNA 
0   NM_167050.1  CG3086-RC, transcript variant C (MAPk-Ak2), mRNA 
0   NM_057878.3  CG5179-RA (Cdk9), mRNA 
0   NM_137485.2  CG17531-RA (GstE7), mRNA 
0   NM_136204.2  CG2615-RA, transcript variant A (ik2), mRNA 
0   NM_165337.1  CG2615-RB, transcript variant B (ik2), mRNA 
0   18  35  NM_057732.3  CG8203-RA (Cdk5), mRNA 
0   NM_132187.2  CG17256-RA (Nek2), mRNA 
0   10  NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_206670.1  CG33224-RA (CG33224), mRNA 
0   12  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_141072.2  CG7177-RA (CG7177), mRNA 
0   10  NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   10  NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   10  NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   10  NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   10  NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   NM_167794.1  CG1210-RE, transcript variant E (Pk61C), mRNA 
0   NM_167793.1  CG1210-RB, transcript variant B (Pk61C), mRNA 
0   NM_167795.1  CG1210-RG, transcript variant G (Pk61C), mRNA 
0   NM_168250.1  CG7892-RG, transcript variant G (nmo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.