National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10498R-2 
 Symbol cdc2c  Full Name cdc2c 
 CG No CG10498  Old CG No CG10498 
 Synonyms Cdk2, cdk2, CDK2, Cdc2c, CG10498, CDK2/CDC2c, S(Sev-CycE)3A, DmCdk2, Dmcdc2c, DmCdc2, Dcdc2c, CDC2c, cdc2c 
 Accession No (Link to NCBI) NM_169916.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCGCCGAAAAGATTGGCGAG 
 Primer Seq. 3'
aatctagaggtaccCCAGAGGGTGACGACTTCGTG 
 Predicted Fragment Size
483 
 IR fragment full Seq
0001 CGCGCCGAAA AGATTGGCGA GGGCACCTAC GGTATAGTTT ACAAAGCGCG TAGCAACTCC 
0061 ACCGGCCAGG ATGTGGCCCT CAAAAAGATT CGGCTAGAAG GCGAAACGGA GGGTGTTCCT 
0121 TCGACGGCCA TTCGAGAGAT CTCCCTGCTG AAGAACCTTA AGCACCCAAA TGTGGTCCAA 
0181 CTATTTGACG TAGTCATTTC CGGCAACAAT CTGTACATGA TATTCGAGTA CCTGAACATG 
0241 GATCTAAAGA AGCTGATGGA TAAGAAAAAA GACGTGTTCA CCCCTCAGTT GATAAAGAGC 
0301 TATATGCATC AGATATTAGA TGCCGTCGGC TTTTGCCACA CGAATCGTAT CCTGCATCGC 
0361 GATCTCAAGC CCCAGAACCT TCTCGTAGAC ACGGCGGGCA AAATAAAGTT GGCTGACTTT 
0421 GGCCTAGCAA GGGCCTTCAA CGTGCCTATG CGGGCGTACA CACACGAAGT CGTCACCCTC 
0481 TGG 
 in silico PCR Fragment
0001 CGCGCCGAAA AGATTGGCGA GGGCACCTAC GGTATAGTTT ACAAAGCGCG TAGCAACTCC 
0061 ACCGGCCAGG ATGTGGCCCT CAAAAAGATT CGGCTAGAAG GCGAAACGGA GGGTGTTCCT 
0121 TCGACGGCCA TTCGAGAGAT CTCCCTGCTG AAGAACCTTA AGCACCCAAA TGTGGTCCAA 
0181 CTATTTGACG TAGTCATTTC CGGCAACAAT CTGTACATGA TATTCGAGTA CCTGAACATG 
0241 GATCTAAAGA AGCTGATGGA TAAGAAAAAA GACGTGTTCA CCCCTCAGTT GATAAAGAGC 
0301 TATATGCATC AGATATTAGA TGCCGTCGGC TTTTGCCACA CGAATCGTAT CCTGCATCGC 
0361 GATCTCAAGC CCCAGAACCT TCTCGTAGAC ACGGCGGGCA AAATAAAGTT GGCTGACTTT 
0421 GGCCTAGCAA GGGCCTTCAA CGTGCCTATG CGGGCGTACA CACACGAAGT CGTCACCCTC 
0481 TGG 
 Assemble Data

10498R-2.IR_full       1   CGCGCCGAAAAGATTGGCGAGGGCACCTACGGTATAGTTTACAAAGCGCGTAGCAACTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     1   CGCGCCGAAAAGATTGGCGAGGGCACCTACGGTATAGTTTACAAAGCGCGTAGCAACTCC 60


10498R-2.IR_full       61  ACCGGCCAGGATGTGGCCCTCAAAAAGATTCGGCTAGAAGGCGAAACGGAGGGTGTTCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     61  ACCGGCCAGGATGTGGCCCTCAAAAAGATTCGGCTAGAAGGCGAAACGGAGGGTGTTCCT 120


10498R-2.IR_full       121 TCGACGGCCATTCGAGAGATCTCCCTGCTGAAGAACCTTAAGCACCCAAATGTGGTCCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     121 TCGACGGCCATTCGAGAGATCTCCCTGCTGAAGAACCTTAAGCACCCAAATGTGGTCCAA 180


10498R-2.IR_full       181 CTATTTGACGTAGTCATTTCCGGCAACAATCTGTACATGATATTCGAGTACCTGAACATG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     181 CTATTTGACGTAGTCATTTCCGGCAACAATCTGTACATGATATTCGAGTACCTGAACATG 240


10498R-2.IR_full       241 GATCTAAAGAAGCTGATGGATAAGAAAAAAGACGTGTTCACCCCTCAGTTGATAAAGAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     241 GATCTAAAGAAGCTGATGGATAAGAAAAAAGACGTGTTCACCCCTCAGTTGATAAAGAGC 300


10498R-2.IR_full       301 TATATGCATCAGATATTAGATGCCGTCGGCTTTTGCCACACGAATCGTATCCTGCATCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     301 TATATGCATCAGATATTAGATGCCGTCGGCTTTTGCCACACGAATCGTATCCTGCATCGC 360


10498R-2.IR_full       361 GATCTCAAGCCCCAGAACCTTCTCGTAGACACGGCGGGCAAAATAAAGTTGGCTGACTTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     361 GATCTCAAGCCCCAGAACCTTCTCGTAGACACGGCGGGCAAAATAAAGTTGGCTGACTTT 420


10498R-2.IR_full       421 GGCCTAGCAAGGGCCTTCAACGTGCCTATGCGGGCGTACACACACGAAGTCGTCACCCTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10498R-2.in silico     421 GGCCTAGCAAGGGCCTTCAACGTGCCTATGCGGGCGTACACACACGAAGTCGTCACCCTC 480


10498R-2.IR_full       481 TGG 483
                           |||
10498R-2.in silico     481 TGG 483

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   465  NM_079696.4  CG10498-RB, transcript variant B (cdc2c), mRNA 
100   465  NM_169916.1  CG10498-RA, transcript variant A (cdc2c), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_057449.3  CG5363-RA (cdc2), mRNA 
0   NM_143454.1  CG7584-RA (Obp99c), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_176688.1  CG3086-RD, transcript variant D (MAPk-Ak2), mRNA 
0   NM_080030.3  CG3086-RB, transcript variant B (MAPk-Ak2), mRNA 
0   NM_167050.1  CG3086-RC, transcript variant C (MAPk-Ak2), mRNA 
0   NM_057878.3  CG5179-RA (Cdk9), mRNA 
0   NM_137485.2  CG17531-RA (GstE7), mRNA 
0   NM_136204.2  CG2615-RA, transcript variant A (ik2), mRNA 
0   NM_165337.1  CG2615-RB, transcript variant B (ik2), mRNA 
0   18  35  NM_057732.3  CG8203-RA (Cdk5), mRNA 
0   NM_132187.2  CG17256-RA (Nek2), mRNA 
0   10  NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_206670.1  CG33224-RA (CG33224), mRNA 
0   12  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_141072.2  CG7177-RA (CG7177), mRNA 
0   10  NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   10  NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   10  NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   10  NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   10  NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   NM_167794.1  CG1210-RE, transcript variant E (Pk61C), mRNA 
0   NM_167793.1  CG1210-RB, transcript variant B (Pk61C), mRNA 
0   NM_167795.1  CG1210-RG, transcript variant G (Pk61C), mRNA 
0   NM_168250.1  CG7892-RG, transcript variant G (nmo), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.