National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10491R-1 
 Symbol vn  Full Name vein 
 CG No CG10491  Old CG No CG10491 
 Synonyms l(3)vn10567, vein, Vein, Vn, CT29452, P1749, ddd, l(3)L6A, wvn, l(3)rF264, l(3)ddd, l(3)10568, l(3)10567, CG10491, vn 
 Accession No (Link to NCBI) NM_079218.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Casso DJ, Biehs B, Kornberg TB.
A novel interaction between hedgehog and Notch promotes proliferation at the anterior-posterior organizer of the Drosophila wing.
Genetics (2011) 187(2) 485-99 [ PubMed ID = 21098717 ] [ RRC reference ]

Xu N, Wang SQ, Tan D, Gao Y, Lin G, Xi R.
EGFR, Wingless and JAK/STAT signaling cooperatively maintain Drosophila intestinal stem cells.
Dev Biol (2011) 354(1) 31-43 [ PubMed ID = 21440535 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGAAGGCAGTGCCGAAGAAAGCAGCTACTATATACCACTGAGTTCGGATAATGGCAGC 60

                           |||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||| silico     61  GGGAGCAGTGAAAGCTCCGCCGAGAGCGGTAGCAGCAGCAGTAGAAGCAGCAGCAACAAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCGACAACAATATCTTAAGTAGGCTGCTCAGCCTCAACAGCAATAGTCTTAGTAGCCGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCAATGTTAAGTTAAAGCCAGCAACAGTATTCGACGCCGGCAGCAGTACACCCGCTCAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGGAGCAACATGTGGCTGCCGTGCCAGAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCAATGCAAAAAGTTCCAAATACGTTAATCAATAGTCAAATATATAATTTATTATACAAT 360

                           |||  |||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     361 GGCATGCCCAGCGAGGCGGCGAGCAGCAAAATGCGTCGCCACATTCAACCATCACAGCTG 420

                           ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| silico     421 CCACATCAGCCAGAGAGCAGAGCGCAATTACCGAGCAACTACAGCAGTCGGCCGGCGGTG 480

10491R-1.IR_full       481 CGGAGCTATCTAATCGAGTC 500
                           |||||||||||||||||||| silico     481 CGGAGCTATCTAATCGAGTC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  145  283  573  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
100.41  484  145  283  573  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
18.46   89  731  1520  2951  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
18.46   89  731  1520  2951  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
18.46   89  731  1520  2951  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
7.05   34  255  641  1365  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
7.05   34  255  641  1365  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
7.05   34  86  472  920  NM_139493.2  CG2083-RA (CG2083), mRNA 
7.05   34  63  482  745  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
7.05   34  59  457  686  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
6.84   33  54  266  513  NM_132004.2  CG4136-RA (CG4136), mRNA 
6.63   32  90  355  586  NM_167000.1  CG32778-RA (CG32778), mRNA 
6.22   30  140  450  908  NM_079903.2  CG15319-RB (nej), mRNA 
6.01   29  167  427  951  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
6.01   29  74  353  432  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
5.8   28  42  157  290  NM_057511.3  CG3936-RA (N), mRNA 
5.6   27  161  428  929  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
5.6   27  161  428  929  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
5.6   27  80  218  395  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
5.6   27  80  218  395  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
5.39   26  58  260  574  NM_079996.2  CG18024-RA (SoxN), mRNA 
5.39   26  57  276  366  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
5.18   25  93  214  574  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
5.18   25  76  267  565  NM_079507.2  CG2530-RA (corto), mRNA 
4.97   24  166  604  1170  NM_001038734.1  CG16902-RC (Hr4), mRNA 
4.97   24  103  320  600  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
4.97   24  103  320  600  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
4.97   24  18  166  229  NM_140438.2  CG32139-RA (Sox21b), mRNA 
4.56   22  147  368  794  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
4.56   22  138  420  630  NM_134474.4  CG32532-RA (CG32532), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.