National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10478R-1 
 Symbol CG10478  Full Name CG10478 
 CG No CG10478  Old CG No CG10478 
 Synonyms g7295403, CG11040, CG10478 
 Accession No (Link to NCBI) NM_139750.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGGACGCTTCGATTGGAAA 
 Primer Seq. 3'
aatctagaggtaccTGGCGATGGTTGAGAGCTTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCgGACGCT TCGATTGGAA AAAGCCAAAA AGGCTGAGCT CCAGAAAGAG CTGACTATTT 
0061 ACAATGCTTT AACCAAATGT AAATTAACCT CCTCGGAAGT TGTTCCCGAC GTCAATAAGT 
0121 TACTTAAGAG CAATACGATA GGAAACCTGG TGGAGTCCCT TGGCCACGGA AATAAGAACA 
0181 AAATTCGAGC CGACGCCGCA GATGCTNTTA GCNTCATATA GCCAGTGGCT CATCGGAGCA 
0241 CTCAAATTTA ATTGCGAAgG CTGGCGCCGT GCCACGATTG ATTCGCCTTC TTCAGTCACC 
0301 CGATCCTGAA GTCTGCGAAA AGGGTATATT GAGTTTGGGG AATCTCTTGC ACTTTGCTCC 
0361 GAACCTCCGT GACTATATCA TAAGACACGG ACTTATGCAA AAGCTGATGT CTATTATTCA 
0421 GGATAAAAGC ACTTGCACTT TAATGTTGAG TCATGTAACC TGGGTTCTAA GAAAACTGTG 
0481 CATAAGCTCT CAACCATCGC CA 
 in silico PCR Fragment
0001 TGCGGACGCT TCGATTGGAA AAAGCCAAAA AGGCTGAGCT CCAGAAAGAG CTGACTATTT 
0061 ACAATGCTTT AACCAAATGT AAATTAACCT CCTCGGAAGT TGTTCCCGAC GTCAATAAGT 
0121 TACTTAAGAG CAATACGATA GGAAACCTGG TGGAGTCCCT TGGCCACGGA AATAAGAACA 
0181 AAATTCGAGC CGACGCCGCA GATGCT-TTA GC-TCATATA GCCAGTGGCT CATCGGAGCA 
0241 CTCAAATTTA ATTGCGAAGG CTGGCGCCGT GCCACGATTG ATTCGCCTTC TTCAGTCACC 
0301 CGATCCTGAA GTCTGCGAAA AGGGTATATT GAGTTTGGGG AATCTCTTGC ACTTTGCTCC 
0361 GAACCTCCGT GACTATATCA TAAGACACGG ACTTATGCAA AAGCTGATGT CTATTATTCA 
0421 GGATAAAAGC ACTTGCACTT TAATGTTGAG TCATGTAACC TGGGTTCTAA GAAAACTGTG 
0481 CATAAGCTCT CAACCATCGC CA 
 Assemble Data

10478R-1.IR_full       1   TGCGGACGCTTCGATTGGAAAAAGCCAAAAAGGCTGAGCTCCAGAAAGAGCTGACTATTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     1   TGCGGACGCTTCGATTGGAAAAAGCCAAAAAGGCTGAGCTCCAGAAAGAGCTGACTATTT 60


10478R-1.IR_full       61  ACAATGCTTTAACCAAATGTAAATTAACCTCCTCGGAAGTTGTTCCCGACGTCAATAAGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     61  ACAATGCTTTAACCAAATGTAAATTAACCTCCTCGGAAGTTGTTCCCGACGTCAATAAGT 120


10478R-1.IR_full       121 TACTTAAGAGCAATACGATAGGAAACCTGGTGGAGTCCCTTGGCCACGGAAATAAGAACA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     121 TACTTAAGAGCAATACGATAGGAAACCTGGTGGAGTCCCTTGGCCACGGAAATAAGAACA 180


10478R-1.IR_full       181 AAATTCGAGCCGACGCCGCAGATGCTNTTAGCNTCATATAGCCAGTGGCTCATCGGAGCA 240
                           |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
10478R-1.in silico     181 AAATTCGAGCCGACGCCGCAGATGCT-TTAGC-TCATATAGCCAGTGGCTCATCGGAGCA 240


10478R-1.IR_full       241 CTCAAATTTAATTGCGAAGGCTGGCGCCGTGCCACGATTGATTCGCCTTCTTCAGTCACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     241 CTCAAATTTAATTGCGAAGGCTGGCGCCGTGCCACGATTGATTCGCCTTCTTCAGTCACC 300


10478R-1.IR_full       301 CGATCCTGAAGTCTGCGAAAAGGGTATATTGAGTTTGGGGAATCTCTTGCACTTTGCTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     301 CGATCCTGAAGTCTGCGAAAAGGGTATATTGAGTTTGGGGAATCTCTTGCACTTTGCTCC 360


10478R-1.IR_full       361 GAACCTCCGTGACTATATCATAAGACACGGACTTATGCAAAAGCTGATGTCTATTATTCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     361 GAACCTCCGTGACTATATCATAAGACACGGACTTATGCAAAAGCTGATGTCTATTATTCA 420


10478R-1.IR_full       421 GGATAAAAGCACTTGCACTTTAATGTTGAGTCATGTAACCTGGGTTCTAAGAAAACTGTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10478R-1.in silico     421 GGATAAAAGCACTTGCACTTTAATGTTGAGTCATGTAACCTGGGTTCTAAGAAAACTGTG 480


10478R-1.IR_full       481 CATAAGCTCTCAACCATCGCCA 502
                           ||||||||||||||||||||||
10478R-1.in silico     481 CATAAGCTCTCAACCATCGCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139750.1  CG10478-RA (CG10478), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_141237.1  CG14655-RA (CG14655), mRNA 
0   NM_167075.1  CG3314-RC, transcript variant C (RpL7A), mRNA 
0   NM_078508.4  CG3314-RD, transcript variant D (RpL7A), mRNA 
0   NM_167073.1  CG3314-RA, transcript variant A (RpL7A), mRNA 
0   NM_141156.2  CG11241-RA (CG11241), mRNA 
0   69  73  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   69  73  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_141130.3  CG11489-RB, transcript variant B (CG11489), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0   NM_144375.2  CG1652-RA (lectin-46Cb), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.