National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10475R-1 
 Symbol Jon65Ai  Full Name Jonah 65Ai 
 CG No CG10475  Old CG No CG10475 
 Synonyms CG10475, CT29408, Jon65A, SP145, Jon65Ai 
 Accession No (Link to NCBI) NM_139758.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            |||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| silico      1   TTCGAGAAGCCGGTTTTCTGGAAGGATGTGCCCGTG-GGCAAG-GCCTCGATCGAAGGT 59

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     61  AGGATCACCATGGGATATCCTGCCTACGAAGGCAAGGTGCCCTACATTGTCGGTTTGGGC 119

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 TTCAGCAAGAACGGTGGA-GGCACCTGGTGCGGCGGTTCCATTATCGGCAACACCTGGGT 179

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     181 GATGACCGCCAAGCATTGTACCGATGGCATGGAATCGGTGACCATCTACTACGGAGCCCT 239

                           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     241 CTGGCGCCTGCAGGCACAGT-ACACCCACTGGGTGGGACGTAGCGACTTCATTGAGCACG 299

                           |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATCTGGAGACATCTCCCTCATTCGCACTCCCCACGTAGACTTCTGGTCGCTGGTCAACA 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGTGGAGCTCCCCAGGTACGACGATCGCTACAACAACTACCAAGGCTGGTGGGCTCTGG 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| silico     421 TCTCCGGATGGGGCAAGACCTCCGATGAGGGCGGTGTCTCCGAGTACCTGAACTGCGTCG 479

10475R-1.IR_full       481 ATGTCCAGATTGGCGAAAACTCCG 503
                           |||||||||||||||||||||||| silico     481 ATGTCCAGATTGGCGAAAACTCCG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
2.9   14  25  36  56  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
1.86   14  41  78  NM_165618.1  CG8579-RA (Jon44E), mRNA 
1.45   18  24  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.82   33  39  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0.82   33  39  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0.41   20  38  62  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.41   14  31  61  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0.41   12  41  64  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.41   12  30  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0.2   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0.2   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   19  54  63  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   12  43  58  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   37  52  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   37  44  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   14  NM_139753.1  CG10477-RA (CG10477), mRNA 
0   11  NM_079220.1  CG6457-RA (yip7), mRNA 
0   11  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_167522.2  CG4429-RB, transcript variant B (Rbp2), mRNA 
0   NM_080220.2  CG4429-RA, transcript variant A (Rbp2), mRNA 
0   NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 
0   NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_137530.1  CG15080-RA (CG15080), mRNA 
0   NM_139760.1  CG10472-RA (CG10472), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   11  18  NM_140084.1  CG18180-RA (CG18180), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.