National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10473R-3 
 Symbol hkl  Full Name hook-like 
 CG No CG10473  Old CG No CG10473 
 Synonyms hkl, CG10473, l(2)37Ba, Ba, CG10437 
 Accession No (Link to NCBI) NM_136091.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGACGCCTAGAAAGCGCAC 
 Primer Seq. 3'
aatctagaggtaccCCTCCTCTGCGGGTTGCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNCGACGCCT AGAAAGCGCA CGGAgNCCAA GGGCGGCGAC AAGAAGGTGG ACACCATACC 
0061 CGAGGAGGAG CCGGAGAATG GAAAGGATGT TGAAAAGGAC GCTGTCGAGG AGGAAAAGAC 
0121 TGTAGCGCCA CCCGCGGCTA ATGAGAGCGA GTCCGAGGAC CGTGCCAAGA CGGAGGATCA 
0181 GCAGGCTCAA GNCGATGAAT CCTGTGCTGA ACCCGCTGTA GTCAAGGATG ATGATGTTGA 
0241 GAAAGAGGAC TTAAAACCGC AGCAGGAGGT CCCCACTTCC ACTGATGATG ACACCAAGCA 
0301 GANCNAGCCA GAACAAGAGG TAAAGNTTCC TTCTCCTTCC AGCAAGGATG AGGAACATCT 
0361 AAAAACGACT AGTGATGTAT TAGACATTCA GACAGAAGAG GTCGATNAAA GGGACGAAGA 
0421 agCCTccGCt CCTGCGGAGC GCAGAGAAAC CAAGAAGAGG CACAAGGAGC AGATAAAGGA 
0481 ACAGCAACCC GCAGAGGAGG  
 in silico PCR Fragment
0001 GACGACGCCT AGAAAGCGCA CGGAGTCCAA GGGCGGCGAC AAGAAGGTGG ACACCATACC 
0061 CGAGGAGGAG CCGGAGAATG GAAAGGATGT TGAAAAGGAC GCTGTCGAGG AGGAAAAGAC 
0121 TGTAGCGCCA CCCGCGGCTA ATGAGAGCGA GTCCGAGGAC CGTGCCAAGA CGGAGGATCA 
0181 GCAGGCTCAA GACGATGAAT CCTGTGCTGA ACCCGCTGTA GTCAAGGATG ATGATGTTGA 
0241 GAAAGAGGAC TTAAAACCGC AGCAGGAGGT CCCCACTTCC ACTGATGATG ACACCAAGCA 
0301 GAGCGAGCCA GAACAAGAGG TAAAGGTTCC TTCTCCTTCC AGCAAGGATG AGGAACATCT 
0361 AAAAACGACT AGTGATGTAT TAGACATTCA GACAGAAGAG GTCGATGAAA GGGACGAAGA 
0421 AGCCTCCGCT CCTGCGGAGC GCAGAGAAAC CAAGAAGAGG CACAAGGAGC AGATAAAGGA 
0481 ACAGCAACCC GCAGAGGAGG  
 Assemble Data

10473R-3.IR_full       1   GNCGACGCCTAGAAAGCGCACGGAGNCCAAGGGCGGCGACAAGAAGGTGGACACCATACC 60
                           | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
10473R-3.in silico     1   GACGACGCCTAGAAAGCGCACGGAGTCCAAGGGCGGCGACAAGAAGGTGGACACCATACC 60


10473R-3.IR_full       61  CGAGGAGGAGCCGGAGAATGGAAAGGATGTTGAAAAGGACGCTGTCGAGGAGGAAAAGAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10473R-3.in silico     61  CGAGGAGGAGCCGGAGAATGGAAAGGATGTTGAAAAGGACGCTGTCGAGGAGGAAAAGAC 120


10473R-3.IR_full       121 TGTAGCGCCACCCGCGGCTAATGAGAGCGAGTCCGAGGACCGTGCCAAGACGGAGGATCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10473R-3.in silico     121 TGTAGCGCCACCCGCGGCTAATGAGAGCGAGTCCGAGGACCGTGCCAAGACGGAGGATCA 180


10473R-3.IR_full       181 GCAGGCTCAAGNCGATGAATCCTGTGCTGAACCCGCTGTAGTCAAGGATGATGATGTTGA 240
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
10473R-3.in silico     181 GCAGGCTCAAGACGATGAATCCTGTGCTGAACCCGCTGTAGTCAAGGATGATGATGTTGA 240


10473R-3.IR_full       241 GAAAGAGGACTTAAAACCGCAGCAGGAGGTCCCCACTTCCACTGATGATGACACCAAGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10473R-3.in silico     241 GAAAGAGGACTTAAAACCGCAGCAGGAGGTCCCCACTTCCACTGATGATGACACCAAGCA 300


10473R-3.IR_full       301 GANCNAGCCAGAACAAGAGGTAAAGNTTCCTTCTCCTTCCAGCAAGGATGAGGAACATCT 360
                           || | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||
10473R-3.in silico     301 GAGCGAGCCAGAACAAGAGGTAAAGGTTCCTTCTCCTTCCAGCAAGGATGAGGAACATCT 360


10473R-3.IR_full       361 AAAAACGACTAGTGATGTATTAGACATTCAGACAGAAGAGGTCGATNAAAGGGACGAAGA 420
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
10473R-3.in silico     361 AAAAACGACTAGTGATGTATTAGACATTCAGACAGAAGAGGTCGATGAAAGGGACGAAGA 420


10473R-3.IR_full       421 AGCCTCCGCTCCTGCGGAGCGCAGAGAAACCAAGAAGAGGCACAAGGAGCAGATAAAGGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10473R-3.in silico     421 AGCCTCCGCTCCTGCGGAGCGCAGAGAAACCAAGAAGAGGCACAAGGAGCAGATAAAGGA 480


10473R-3.IR_full       481 ACAGCAACCCGCAGAGGAGG 500
                           ||||||||||||||||||||
10473R-3.in silico     481 ACAGCAACCCGCAGAGGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165273.1  CG10473-RB, transcript variant B (CG10473), mRNA 
100   482  NM_136091.3  CG10473-RA, transcript variant A (CG10473), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_140603.1  CG13049-RB, transcript variant B (CG13049), mRNA 
0   NM_168657.1  CG13049-RA, transcript variant A (CG13049), mRNA 
0   13  NM_137755.2  CG15675-RA, transcript variant A (CG15675), mRNA 
0   NM_080369.2  CG12055-RA, transcript variant A (Gapdh1), mRNA 
0   NM_001038847.1  CG12055-RB, transcript variant B (Gapdh1), mRNA 
0   NM_169632.1  CG6384-RB, transcript variant B (Cp190), mRNA 
0   NM_079635.2  CG6384-RA, transcript variant A (Cp190), mRNA 
0   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_143336.1  CG5003-RA (CG5003), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_057660.2  CG4758-RA, transcript variant A (Trp1), mRNA 
0   NM_164885.1  CG4758-RB, transcript variant B (Trp1), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_058143.3  CG3218-RA (fs(1)K10), mRNA 
0   NM_078564.2  CG1594-RA (hop), mRNA 
0   NM_166443.1  CG9485-RA, transcript variant A (CG9485), mRNA 
0   NM_166444.1  CG9485-RB, transcript variant B (CG9485), mRNA 
0   NM_137733.2  CG9485-RC, transcript variant C (CG9485), mRNA 
0   NM_132895.2  CG9984-RA (TH1), mRNA 
0   NM_141608.2  CG18005-RA (CG18005), mRNA 
0   NM_167276.1  CG1938-RB, transcript variant B (Dlic2), mRNA 
0   NM_167274.1  CG1938-RD, transcript variant D (Dlic2), mRNA 
0   NM_132466.2  CG1938-RA, transcript variant A (Dlic2), mRNA 
0   NM_167273.1  CG1938-RC, transcript variant C (Dlic2), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++  
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.