National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1044R-3 
 Symbol dos  Full Name daughter of sevenless 
 CG No CG1044  Old CG No CG1044 
 Synonyms 141511_at, Dos, DOS, Su(sev)3A, E(csw)3A, Su(sev[S11])3A, E(csw[CS])3A, CG1044, dos 
 Accession No (Link to NCBI) NM_079166.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lu TY, Doherty J, Freeman MR.
DRK/DOS/SOS converge with Crk/Mbc/dCed-12 to activate Rac1 during glial engulfment of axonal debris.
Proc. Natl. Acad. Sci. U.S.A. (2014) 111(34) 12544-9 [ PubMed ID = 25099352 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATCGCACTTTCTACGAGGG 
 Primer Seq. 3'
aatctagaggtaccAAGCCTGAGGCGCTGTGGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGATCGCACT TTCTACGAGG GCTGGCTAAT TAAGTCGCCG CCCACCAAGC GCATTTGGCG 
0061 AGCACGCTGG AGGCGTCGCN TACTTCACGC TGAAGCAGGG CGAGATACCG GAGCAGTTCT 
0121 GCCTCGAATA CTACACCGAC CACAACTGCC GCAAGCTGAA GGGCGTTATC GATTTGGATC 
0181 AGTGCGAGCA GGTGGACTGT GGCCTGCGGC TGGAGAATCG CAAGCAGAAG TTTCAGTACA 
0241 TGTTCGATAT CAANGACGCC CAAGCGCACC TACTACCTGG CTGCTGAGAC GGAGGCGGAT 
0301 ATGCGCGACT GGGTGAACTG CATCTGCCAG GTGTGTCACC TACACGACAC AAAGCAATCG 
0361 AATGAGTTGC CATTAGGAGC TGTGGGTGCA GACGAAAACC GCACCCAACA CACGAGCTCC 
0421 AGTGGCGGTC TAAGCAACTC CACTCAAAAT ACGACCACCA CATCGTTGCA CTCGTCGGCC 
0481 GGAACCACAG CGCCTCAGGC TT 
 in silico PCR Fragment
0001 GGATCGCACT TTCTACGAGG GCTGGCTAAT TAAGTCGCCG CCCACCAAGC GCATTTGGCG 
0061 AGCACGCTGG AGGCGTCGC- TACTTCACGC TGAAGCAGGG CGAGATACCG GAGCAGTTCT 
0121 GCCTCGAATA CTACACCGAC CACAACTGCC GCAAGCTGAA GGGCGTTATC GATTTGGATC 
0181 AGTGCGAGCA GGTGGACTGT GGCCTGCGGC TGGAGAATCG CAAGCAGAAG TTTCAGTACA 
0241 TGTTCGATAT CAA-GACGCC CAAGCGCACC TACTACCTGG CTGCTGAGAC GGAGGCGGAT 
0301 ATGCGCGACT GGGTGAACTG CATCTGCCAG GTGTGTCACC TACACGACAC AAAGCAATCG 
0361 AATGAGTTGC CATTAGGAGC TGTGGGTGCA GACGAAAACC GCACCCAACA CACGAGCTCC 
0421 AGTGGCGGTC TAAGCAACTC CACTCAAAAT ACGACCACCA CATCGTTGCA CTCGTCGGCC 
0481 GGAACCACAG CGCCTCAGGC TT 
 Assemble Data

1044R-3.IR_full       1   GGATCGCACTTTCTACGAGGGCTGGCTAATTAAGTCGCCGCCCACCAAGCGCATTTGGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     1   GGATCGCACTTTCTACGAGGGCTGGCTAATTAAGTCGCCGCCCACCAAGCGCATTTGGCG 60


1044R-3.IR_full       61  AGCACGCTGGAGGCGTCGCNTACTTCACGCTGAAGCAGGGCGAGATACCGGAGCAGTTCT 120
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     61  AGCACGCTGGAGGCGTCGC-TACTTCACGCTGAAGCAGGGCGAGATACCGGAGCAGTTCT 120


1044R-3.IR_full       121 GCCTCGAATACTACACCGACCACAACTGCCGCAAGCTGAAGGGCGTTATCGATTTGGATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     121 GCCTCGAATACTACACCGACCACAACTGCCGCAAGCTGAAGGGCGTTATCGATTTGGATC 180


1044R-3.IR_full       181 AGTGCGAGCAGGTGGACTGTGGCCTGCGGCTGGAGAATCGCAAGCAGAAGTTTCAGTACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     181 AGTGCGAGCAGGTGGACTGTGGCCTGCGGCTGGAGAATCGCAAGCAGAAGTTTCAGTACA 240


1044R-3.IR_full       241 TGTTCGATATCAANGACGCCCAAGCGCACCTACTACCTGGCTGCTGAGACGGAGGCGGAT 300
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     241 TGTTCGATATCAA-GACGCCCAAGCGCACCTACTACCTGGCTGCTGAGACGGAGGCGGAT 300


1044R-3.IR_full       301 ATGCGCGACTGGGTGAACTGCATCTGCCAGGTGTGTCACCTACACGACACAAAGCAATCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     301 ATGCGCGACTGGGTGAACTGCATCTGCCAGGTGTGTCACCTACACGACACAAAGCAATCG 360


1044R-3.IR_full       361 AATGAGTTGCCATTAGGAGCTGTGGGTGCAGACGAAAACCGCACCCAACACACGAGCTCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     361 AATGAGTTGCCATTAGGAGCTGTGGGTGCAGACGAAAACCGCACCCAACACACGAGCTCC 420


1044R-3.IR_full       421 AGTGGCGGTCTAAGCAACTCCACTCAAAATACGACCACCACATCGTTGCACTCGTCGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1044R-3.in silico     421 AGTGGCGGTCTAAGCAACTCCACTCAAAATACGACCACCACATCGTTGCACTCGTCGGCC 480


1044R-3.IR_full       481 GGAACCACAGCGCCTCAGGCTT 502
                          ||||||||||||||||||||||
1044R-3.in silico     481 GGAACCACAGCGCCTCAGGCTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
96.47   465  NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_133068.2  CG6361-RA (CG6361), mRNA 
0   NM_132627.1  CG4346-RA (rad), mRNA 
0   NM_139405.1  CG12020-RA (CG12020), mRNA 
0   NM_169841.1  CG17836-RD, transcript variant D (CG17836), mRNA 
0   NM_169840.1  CG17836-RC, transcript variant C (CG17836), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_136586.1  CG13748-RA (CG13748), mRNA 
0   NM_130526.2  CG3655-RA (CG3655), mRNA 
0   NM_078835.2  CG12283-RA (kek1), mRNA 
0   NM_079308.2  CG18593-RA (viaf), mRNA 
0   NM_001032405.1  CG33956-RE, transcript variant E (kay), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
0   NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0   NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
0   NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 
0   NM_168904.2  CG5683-RC, transcript variant C (Aef1), mRNA 
0   NM_168903.2  CG5683-RA, transcript variant A (Aef1), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_140605.1  CG13047-RA (CG13047), mRNA 
0   NM_140181.1  CG12522-RA (CG12522), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_135435.3  CG4454-RA, transcript variant A (Borr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.