National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1044R-3 
 Symbol dos  Full Name daughter of sevenless 
 CG No CG1044  Old CG No CG1044 
 Synonyms 141511_at, Dos, DOS, Su(sev)3A, E(csw)3A, Su(sev[S11])3A, E(csw[CS])3A, CG1044, dos 
 Accession No (Link to NCBI) NM_079166.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Lu TY, Doherty J, Freeman MR.
DRK/DOS/SOS converge with Crk/Mbc/dCed-12 to activate Rac1 during glial engulfment of axonal debris.
Proc. Natl. Acad. Sci. U.S.A. (2014) 111(34) 12544-9 [ PubMed ID = 25099352 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGATCGCACTTTCTACGAGGGCTGGCTAATTAAGTCGCCGCCCACCAAGCGCATTTGGCG 60

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     61  AGCACGCTGGAGGCGTCGC-TACTTCACGCTGAAGCAGGGCGAGATACCGGAGCAGTTCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCTCGAATACTACACCGACCACAACTGCCGCAAGCTGAAGGGCGTTATCGATTTGGATC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGTGCGAGCAGGTGGACTGTGGCCTGCGGCTGGAGAATCGCAAGCAGAAGTTTCAGTACA 240

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTTCGATATCAA-GACGCCCAAGCGCACCTACTACCTGGCTGCTGAGACGGAGGCGGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGCGCGACTGGGTGAACTGCATCTGCCAGGTGTGTCACCTACACGACACAAAGCAATCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AATGAGTTGCCATTAGGAGCTGTGGGTGCAGACGAAAACCGCACCCAACACACGAGCTCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGTGGCGGTCTAAGCAACTCCACTCAAAATACGACCACCACATCGTTGCACTCGTCGGCC 480

1044R-3.IR_full       481 GGAACCACAGCGCCTCAGGCTT 502
                          |||||||||||||||||||||| silico     481 GGAACCACAGCGCCTCAGGCTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
96.47   465  NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_133068.2  CG6361-RA (CG6361), mRNA 
0   NM_132627.1  CG4346-RA (rad), mRNA 
0   NM_139405.1  CG12020-RA (CG12020), mRNA 
0   NM_169841.1  CG17836-RD, transcript variant D (CG17836), mRNA 
0   NM_169840.1  CG17836-RC, transcript variant C (CG17836), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_136586.1  CG13748-RA (CG13748), mRNA 
0   NM_130526.2  CG3655-RA (CG3655), mRNA 
0   NM_078835.2  CG12283-RA (kek1), mRNA 
0   NM_079308.2  CG18593-RA (viaf), mRNA 
0   NM_001032405.1  CG33956-RE, transcript variant E (kay), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
0   NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0   NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
0   NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 
0   NM_168904.2  CG5683-RC, transcript variant C (Aef1), mRNA 
0   NM_168903.2  CG5683-RA, transcript variant A (Aef1), mRNA 
0   NM_206222.1  CG7036-RB, transcript variant B (rno), mRNA 
0   NM_138163.1  CG7036-RA, transcript variant A (rno), mRNA 
0   NM_140605.1  CG13047-RA (CG13047), mRNA 
0   NM_140181.1  CG12522-RA (CG12522), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   NM_140195.2  CG6190-RA (As), mRNA 
0   NM_135435.3  CG4454-RA, transcript variant A (Borr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.