National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10444R-1 
 Symbol CG10444  Full Name CG10444 
 CG No CG10444  Old CG No CG10444 
 Synonyms CG10444 
 Accession No (Link to NCBI) NM_137621.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     1   CAACATTGCCTACGTGCTGAGTACGCCCATTGC-CGCGTACTTCTTCCTTCCTGTTTTCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACAGGATGCGGACGACCAGTGTGTACGAGTATCTGGAGCGGCGCTTTGGCCAGGCCACCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCTGTCCGCCTCCCTGGCCTTCACCGTGCAAATGGTGCTTTACATGGGCATTGCACTCT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGCACCAGCGCTCGCTTTAGAAGCTGTAACCGGCATTCATCGGTCAATGGCCATCGTGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     241 TCATTGGACTGGTGTGCACCTTCTATTCGACACTTGGCGGCCTGAA-GGCGGTGCTCATC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGGATGTGTTTCAGTCCTTCCTCATGTTTGCCGCCATCTACGCCGTGATTGCCGTGTCG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCCATTAAAGCCGGCGGATTCGCGGCCATCTGGGATGTGGCTGTGGAGCGAGGACGCGTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACTTCATTGAGTTTTCATTGGATCCCACCGTGAGGCATACTTGGTGGTCTCTGATCATT 480

10444R-1.IR_full       481 GGCGGCATGGTCACTTACCTCT 502
                           |||||||||||||||||||||| silico     481 GGCGGCATGGTCACTTACCTCT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137621.2  CG10444-RA (CG10444), mRNA 
0.82   15  47  NM_167256.1  CG32669-RA (CG32669), mRNA 
0   NM_135550.1  CG5362-RA (CG5362), mRNA 
0   NM_057369.3  CG12181-RB (Sgs4), mRNA 
0   NM_136574.2  CG8258-RA (CG8258), mRNA 
0   NM_079629.2  CG7390-RA, transcript variant A (smp-30), mRNA 
0   NM_169602.1  CG7390-RB, transcript variant B (smp-30), mRNA 
0   NM_057813.3  CG6141-RA, transcript variant A (RpL9), mRNA 
0   NM_164955.1  CG6141-RB, transcript variant B (RpL9), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_001014729.1  CG32697-RE, transcript variant E (l(1)G0232), mRNA 
0   NM_167199.1  CG32697-RD, transcript variant D (l(1)G0232), mRNA 
0   NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
0   NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
0   NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
0   NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   NM_135848.2  CG16873-RA (CG16873), mRNA 
0   NM_137986.2  CG13561-RA (CG13561), mRNA 
0   NM_140250.1  CG5964-RA (CG5964), mRNA 
0   NM_144358.2  CG14233-RA (meso18E), mRNA 
0   NM_143460.2  CG7601-RA (CG7601), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   10  15  NM_165304.1  CG10084-RB, transcript variant B (swm), mRNA 
0   10  NM_136132.4  CG10084-RA, transcript variant A (swm), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_078873.2  CG15162-RA (MESR3), mRNA 
0   NM_170116.1  CG5422-RB, transcript variant B (Rox8), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.