National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10435R-3 
 Symbol CG10435  Full Name CG10435 
 CG No CG10435  Old CG No CG10435 
 Synonyms CG10435 
 Accession No (Link to NCBI) NM_141502.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACCAGACACAGCTGGAGAA 
 Primer Seq. 3'
aatctagaggtaccTGTCAGGCACACTCCTTGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACCAGACA CAGCTGGAGA AGCGCATAGA TCAACAGCAG CAGGATCAGC AGCACCAGGA 
0061 GCCGCCGCAT GAGGATCATT CCAAGGAGGA GCAATCTGGC AATGAANGTG CCAGCCTCCG 
0121 GTGGAGCTAN GCAATGACTA CGCTGGCGGA GACCGAAAGC GACGCTCGAC AGCGTCAATT 
0181 TCCATGTTCA CTGTGATGAT AATGCGGACA GGGGCGAGCC AAGCCACATT CCAACCACGG 
0241 CTCAATACCT AACGCCCATG TANCAGCGCT TCCGCCCAGC AGCCGTTGCA TAAACCGGAA 
0301 CACTTTCAGG TGTACCACAT GCAGGGCTAC AGTCACCAGC CCTTCTACCC TCCGCAGCAG 
0361 CATTCTTTCC AACAGTTTAG CAACTACCAA GTCAATGGAT TCGGGACTCA AAACCTTTTG 
0421 AAGGCTCCTC CAGCGCCTTC CTCCGTGCAT GCGCTCAGCC AGTCGGAGGA CGAGGTAGCC 
0481 ACGAAGTCAA GGAGTGTGCC TGACA 
 in silico PCR Fragment
0001 GCACCAGACA CAGCTGGAGA AGCGCATAGA TCAACAGCAG CAGGATCAGC AGCAGCAGGA 
0061 GCCGCCGCAT GAGGATCATT CCAAGGAGGA GCAATCTGGC AATGAA-GTG CCAG-CTCCG 
0121 GTGGAGCTA- GCAATGACTA CGCTGGCGGA GACC-AAAGC GACGCTCGAC AGCGTCAATT 
0181 TCCATGTTCA CTGTGATGAT AATGCGGACA GGGGCGAGCC AAGCCACATT CCAACCACGG 
0241 CTCAATACCT AACGCCCATG TA-CAGCGCT TCCGCCCAGC AGCCGTTGCA TAAACCGGAA 
0301 CACTTTCAGG TGTACCACAT GCAGGGCTAC AGTCACCAGC CCTTCTACCC TCCGCAGCAG 
0361 CATTCTTTCC AACAGTTTAG CAACTACCAA GTCAATGGAT TCGGGACTCA AAACCTTTTG 
0421 AAGGCTCCTC CAGCGCCTTC CTCCGTGCAT GCGCTCAGCC AGTCGGAGGA CGAGGTAGCC 
0481 ACGAAGTCAA GGAGTGTGCC TGACA 
 Assemble Data

10435R-3.IR_full       1   GCACCAGACACAGCTGGAGAAGCGCATAGATCAACAGCAGCAGGATCAGCAGCACCAGGA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10435R-3.in silico     1   GCACCAGACACAGCTGGAGAAGCGCATAGATCAACAGCAGCAGGATCAGCAGCAGCAGGA 60


10435R-3.IR_full       61  GCCGCCGCATGAGGATCATTCCAAGGAGGAGCAATCTGGCAATGAANGTGCCAGCCTCCG 120
                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||
10435R-3.in silico     61  GCCGCCGCATGAGGATCATTCCAAGGAGGAGCAATCTGGCAATGAA-GTGCCAG-CTCCG 120


10435R-3.IR_full       121 GTGGAGCTANGCAATGACTACGCTGGCGGAGACCGAAAGCGACGCTCGACAGCGTCAATT 180
                           ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||
10435R-3.in silico     121 GTGGAGCTA-GCAATGACTACGCTGGCGGAGACC-AAAGCGACGCTCGACAGCGTCAATT 180


10435R-3.IR_full       181 TCCATGTTCACTGTGATGATAATGCGGACAGGGGCGAGCCAAGCCACATTCCAACCACGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10435R-3.in silico     181 TCCATGTTCACTGTGATGATAATGCGGACAGGGGCGAGCCAAGCCACATTCCAACCACGG 240


10435R-3.IR_full       241 CTCAATACCTAACGCCCATGTANCAGCGCTTCCGCCCAGCAGCCGTTGCATAAACCGGAA 300
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10435R-3.in silico     241 CTCAATACCTAACGCCCATGTA-CAGCGCTTCCGCCCAGCAGCCGTTGCATAAACCGGAA 300


10435R-3.IR_full       301 CACTTTCAGGTGTACCACATGCAGGGCTACAGTCACCAGCCCTTCTACCCTCCGCAGCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10435R-3.in silico     301 CACTTTCAGGTGTACCACATGCAGGGCTACAGTCACCAGCCCTTCTACCCTCCGCAGCAG 360


10435R-3.IR_full       361 CATTCTTTCCAACAGTTTAGCAACTACCAAGTCAATGGATTCGGGACTCAAAACCTTTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10435R-3.in silico     361 CATTCTTTCCAACAGTTTAGCAACTACCAAGTCAATGGATTCGGGACTCAAAACCTTTTG 420


10435R-3.IR_full       421 AAGGCTCCTCCAGCGCCTTCCTCCGTGCATGCGCTCAGCCAGTCGGAGGACGAGGTAGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10435R-3.in silico     421 AAGGCTCCTCCAGCGCCTTCCTCCGTGCATGCGCTCAGCCAGTCGGAGGACGAGGTAGCC 480


10435R-3.IR_full       481 ACGAAGTCAAGGAGTGTGCCTGACA 505
                           |||||||||||||||||||||||||
10435R-3.in silico     481 ACGAAGTCAAGGAGTGTGCCTGACA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_141502.2  CG10435-RA (CG10435), mRNA 
0.62   12  NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0.62   12  NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
0.62   NM_141323.1  CG2097-RA (CG2097), mRNA 
0.41   NM_142075.1  CG14358-RA (CG14358), mRNA 
0.2   10  15  NM_142007.2  CG8483-RA (CG8483), mRNA 
0.2   52  NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   14  29  65  NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   13  18  71  NM_164960.1  CG32830-RA (CG32830), mRNA 
0   12  11  26  NM_136028.2  CG7180-RA (CG7180), mRNA 
0   11  64  206  NM_132665.1  CG15753-RA (CG15753), mRNA 
0   38  182  NM_078575.2  CG9355-RA (dy), mRNA 
0   20  82  NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   20  82  NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   11  65  NM_130728.1  CG15240-RA (CG15240), mRNA 
0   44  218  NM_206089.1  CG33473-RB (luna), mRNA 
0   42  173  NM_078797.2  CG13109-RA (tai), mRNA 
0   31  222  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   31  222  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   17  129  NM_001032019.1  CG3992-RD, transcript variant D (srp), mRNA 
0   51  NM_167279.1  CG18361-RB, transcript variant B (dsh), mRNA 
0   51  NM_078563.2  CG18361-RA, transcript variant A (dsh), mRNA 
0   99  417  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   32  145  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   13  60  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   48  NM_136600.1  CG13743-RA (CG13743), mRNA 
0   NM_135940.2  CG17329-RA (CG17329), mRNA 
0   103  462  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   103  462  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   43  162  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.