National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1041R-1 
 Symbol CG1041  Full Name CG1041 
 CG No CG1041  Old CG No CG1041 
 Synonyms CG1041 
 Accession No (Link to NCBI) NM_141393.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGTTCCGTGGCAATGGAAAG 
 Primer Seq. 3'
aatctagaggtaccGCGTGCACCATGTCGTTGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGTTCCGTG GCAATGGAAA GCTTTTGTGG AATTTGACCA AGAACTCCTT GGCCCAGCAG 
0061 TCTCCAAATG GGATCGCCAA GAAAGTGCTG CCCGCTAGCA GCTACAGCAC CGTCCAGAAG 
0121 ACCATTCCCT TGGAGCAGCC CGAATCTGCT GAAGTACCAC GTCCTGCCGC TGGAGGAAAC 
0181 GCTGAACCGC TTCATGACCA CTGTGGAACC TCTCCTGACG CCTGAGGAGT TTCAACGGCA 
0241 AAAGGGAATC ACCTCCGAGT TTTTAAAAAA GCAGGGACGC GAACTGCAGC TGCTCCTGGA 
0301 AGAAACCGGC AGCAAGGAGA AGAATTGGCT GGCCCACCGC TGGCTGAAGG CTGCCTATTT 
0361 GACCTATCGA GATCCAGTCA CCGTGTTCGT GAGTCCTGGC ATGACCTTTC CCAAGCAAAA 
0421 CTTCAGGGAC TCACGTGCTT TCGTGGACTA TACCGCCAGG GTTATCTATG GACTGGGAGA 
0481 ATTCAACGAC ATGTGTCGCA CGC 
 in silico PCR Fragment
0001 AAGTTCCGTG GCAATGGAAA GCTTTTGTGG AATTTGACCA AGAACTCCTT GGCCCAGCAG 
0061 TCTCCAAATG GGATCGCCAA GAAAGTGCTG CCCGCTAGCA GCTACAGCAC CGTCCAGAAG 
0121 ACCATTCCCT TGGAGCAG-C CGAATCTGCT GAAGTACCAC GTCCTGCCGC TGGAGGAAAC 
0181 GCTGAACCGC TTCATGACCA CTGTGGAACC TCTCCTGACG CCTGAGGAGT TTCAACGGCA 
0241 AAAGGGAATC ACCTCCGAGT TTTTAAAAAA GCAGGGACGC GAACTGCAGC TGCTCCTGGA 
0301 AGAAACCGGC AGCAAGGAGA AGAATTGGCT GGCCCACCGC TGGCTGAAGG CTGCCTATTT 
0361 GACCTATCGA GATCCAGTCA CCGTGTTCGT GAGTCCTGGC ATGACCTTTC CCAAGCAAAA 
0421 CTTCAGGGAC TCACGTGCTT TCGTGGACTA TACCGCCAGG GTTATCTATG GACTGGGAGA 
0481 ATTCAACGAC ATG-GT-GCA CGC 
 Assemble Data

1041R-1.IR_full       1   AAGTTCCGTGGCAATGGAAAGCTTTTGTGGAATTTGACCAAGAACTCCTTGGCCCAGCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     1   AAGTTCCGTGGCAATGGAAAGCTTTTGTGGAATTTGACCAAGAACTCCTTGGCCCAGCAG 60


1041R-1.IR_full       61  TCTCCAAATGGGATCGCCAAGAAAGTGCTGCCCGCTAGCAGCTACAGCACCGTCCAGAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     61  TCTCCAAATGGGATCGCCAAGAAAGTGCTGCCCGCTAGCAGCTACAGCACCGTCCAGAAG 120


1041R-1.IR_full       121 ACCATTCCCTTGGAGCAGCCCGAATCTGCTGAAGTACCACGTCCTGCCGCTGGAGGAAAC 180
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     121 ACCATTCCCTTGGAGCAG-CCGAATCTGCTGAAGTACCACGTCCTGCCGCTGGAGGAAAC 180


1041R-1.IR_full       181 GCTGAACCGCTTCATGACCACTGTGGAACCTCTCCTGACGCCTGAGGAGTTTCAACGGCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     181 GCTGAACCGCTTCATGACCACTGTGGAACCTCTCCTGACGCCTGAGGAGTTTCAACGGCA 240


1041R-1.IR_full       241 AAAGGGAATCACCTCCGAGTTTTTAAAAAAGCAGGGACGCGAACTGCAGCTGCTCCTGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     241 AAAGGGAATCACCTCCGAGTTTTTAAAAAAGCAGGGACGCGAACTGCAGCTGCTCCTGGA 300


1041R-1.IR_full       301 AGAAACCGGCAGCAAGGAGAAGAATTGGCTGGCCCACCGCTGGCTGAAGGCTGCCTATTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     301 AGAAACCGGCAGCAAGGAGAAGAATTGGCTGGCCCACCGCTGGCTGAAGGCTGCCTATTT 360


1041R-1.IR_full       361 GACCTATCGAGATCCAGTCACCGTGTTCGTGAGTCCTGGCATGACCTTTCCCAAGCAAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     361 GACCTATCGAGATCCAGTCACCGTGTTCGTGAGTCCTGGCATGACCTTTCCCAAGCAAAA 420


1041R-1.IR_full       421 CTTCAGGGACTCACGTGCTTTCGTGGACTATACCGCCAGGGTTATCTATGGACTGGGAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1041R-1.in silico     421 CTTCAGGGACTCACGTGCTTTCGTGGACTATACCGCCAGGGTTATCTATGGACTGGGAGA 480


1041R-1.IR_full       481 ATTCAACGACATGTGTCGCACGC 503
                          ||||||||||||| || ||||||
1041R-1.in silico     481 ATTCAACGACATG-GT-GCACGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141393.2  CG1041-RA, transcript variant A (CG1041), mRNA 
100   482  NM_001043219.1  CG1041-RB, transcript variant B (CG1041), mRNA 
0.62   NM_166443.1  CG9485-RA, transcript variant A (CG9485), mRNA 
0.62   NM_166444.1  CG9485-RB, transcript variant B (CG9485), mRNA 
0.62   NM_137733.2  CG9485-RC, transcript variant C (CG9485), mRNA 
0   13  19  28  NM_142348.1  CG5265-RA (CG5265), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_170221.1  CG31087-RA (CG31087), mRNA 
0   NM_141324.1  CG1098-RA (Madm), mRNA 
0   NM_166689.1  CG3629-RB, transcript variant B (Dll), mRNA 
0   NM_079133.1  CG3629-RA, transcript variant A (Dll), mRNA 
0   NM_144344.2  CG17178-RA (ACXE), mRNA 
0   NM_166516.1  CG11170-RB (CG11170), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NM_139474.2  CG12182-RA (CG12182), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_135898.2  CG15267-RA (CG15267), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_142641.1  CG5434-RA (Srp72), mRNA 
0   NM_165888.2  CG30049-RA (CG30049), mRNA 
0   10  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_137613.2  CG11099-RA (CG11099), mRNA 
0   NM_132464.2  CG1908-RA (CG1908), mRNA 
0   NM_134603.1  CG1489-RA (Pros45), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_168550.1  CG10089-RC, transcript variant C (CG10089), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
+- 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.