National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1041R-1 
 Symbol CG1041  Full Name CG1041 
 CG No CG1041  Old CG No CG1041 
 Synonyms CG1041 
 Accession No (Link to NCBI) NM_141393.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGTTCCGTGGCAATGGAAAGCTTTTGTGGAATTTGACCAAGAACTCCTTGGCCCAGCAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTCCAAATGGGATCGCCAAGAAAGTGCTGCCCGCTAGCAGCTACAGCACCGTCCAGAAG 120

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 ACCATTCCCTTGGAGCAG-CCGAATCTGCTGAAGTACCACGTCCTGCCGCTGGAGGAAAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGAACCGCTTCATGACCACTGTGGAACCTCTCCTGACGCCTGAGGAGTTTCAACGGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAAGGGAATCACCTCCGAGTTTTTAAAAAAGCAGGGACGCGAACTGCAGCTGCTCCTGGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGAAACCGGCAGCAAGGAGAAGAATTGGCTGGCCCACCGCTGGCTGAAGGCTGCCTATTT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCTATCGAGATCCAGTCACCGTGTTCGTGAGTCCTGGCATGACCTTTCCCAAGCAAAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTTCAGGGACTCACGTGCTTTCGTGGACTATACCGCCAGGGTTATCTATGGACTGGGAGA 480

1041R-1.IR_full       481 ATTCAACGACATGTGTCGCACGC 503
                          ||||||||||||| || |||||| silico     481 ATTCAACGACATG-GT-GCACGC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141393.2  CG1041-RA, transcript variant A (CG1041), mRNA 
100   482  NM_001043219.1  CG1041-RB, transcript variant B (CG1041), mRNA 
0.62   NM_166443.1  CG9485-RA, transcript variant A (CG9485), mRNA 
0.62   NM_166444.1  CG9485-RB, transcript variant B (CG9485), mRNA 
0.62   NM_137733.2  CG9485-RC, transcript variant C (CG9485), mRNA 
0   13  19  28  NM_142348.1  CG5265-RA (CG5265), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_170221.1  CG31087-RA (CG31087), mRNA 
0   NM_141324.1  CG1098-RA (Madm), mRNA 
0   NM_166689.1  CG3629-RB, transcript variant B (Dll), mRNA 
0   NM_079133.1  CG3629-RA, transcript variant A (Dll), mRNA 
0   NM_144344.2  CG17178-RA (ACXE), mRNA 
0   NM_166516.1  CG11170-RB (CG11170), mRNA 
0   NM_137139.1  CG12858-RA (CG12858), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NM_139474.2  CG12182-RA (CG12182), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_135898.2  CG15267-RA (CG15267), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_142641.1  CG5434-RA (Srp72), mRNA 
0   NM_165888.2  CG30049-RA (CG30049), mRNA 
0   10  NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_137613.2  CG11099-RA (CG11099), mRNA 
0   NM_132464.2  CG1908-RA (CG1908), mRNA 
0   NM_134603.1  CG1489-RA (Pros45), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_168550.1  CG10089-RC, transcript variant C (CG10089), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.