National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10415R-3 
 Symbol TfIIEalpha  Full Name Transcription factor IIEalpha 
 CG No CG10415  Old CG No CG10415 
 Synonyms TfIIEa, TFIIE, TFIIEalpha, TFIIE-L, CG10415, dTFIIEL, dTFIIE-L, TfIIE, TfIIEalpha 
 Accession No (Link to NCBI) NM_079302.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGTCGACATCGACGGCT 
 Primer Seq. 3'
aatctagaggtaccGGAACTCCAGCGTGGCCATGT 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ATGTCGTCGA CATCGACGGC TGCAGCGAAC GCAGCGCCAG CGAAAACGGA GGTGCGGTAC 
0061 GTGACCGAGG TGCCCAGCAG TCTGAANGCA ACTGGCGCGC CTCGTGGTCC GTGGATTCTA 
0121 TTCCCTGGAG GATGCGCTTA TCATCGACAT GCTGGTGCGG AATCCCTGCA TGAAGGAGGA 
0181 CGACATCGGC GAGCTGTTGC GCTTTCGAGA AGAAGCAGTT AAGGGCCCGG ATAACCACGC 
0241 TGCGCACCGA CAAGTTCATC CAGATCAGGC TTAAAATGGA AACGGGGCCG GATGGTAAGG 
0301 CGCAGAAGGT CAATTACTAC TTCATCAACT ACAAGACCTT CGTGAACGTG GTGAAGTACA 
0361 AGCTGGATCT CATGCGCAAG CGTATGGNAG ACGGAGGAGC GTGATGCCAC CAGTAGAGCA 
0421 AGTTTTAAGT GCTCTTCGTG TTCCAAAACA TTCACGGACC TCGAAGCGGA CCAGCTGTTC 
0481 GACATGGCCA CGCTGGAGTT CC 
 in silico PCR Fragment
0001 ATGTCGTCGA CATCGACGGC TGCAGCGAAC GCAGCGCCAG CGAAGACGGA GGTGCGGTAC 
0061 GTGACCGAGG TGCCCAGCAG TCTGAA-GCA ACTGGCGCGC CTCGTGGTCC GTGGATTCTA 
0121 TTCCCTGGAG GATGCGCTTA TCATCGACAT GCTGGTGCGG AATCCCTGCA TGAAGGAGGA 
0181 CGACATCGGC GAGCTGTTGC GC-TTCGAGA AGAAGCAGTT AAGGGCCCGG ATAACCACGC 
0241 TGCGCACCGA CAAGTTCATC CAGATCAGGC TTAAAATGGA AACGGGGCCG GATGGTAAGG 
0301 CGCAGAAGGT CAATTACTAC TTCATCAACT ACAAGACCTT CGTGAACGTG GTGAAGTACA 
0361 AGCTGGATCT CATGCGCAAG CGTATGG-AG ACGGAGGAGC GTGATGCCAC CAGTAGAGCA 
0421 AGTTTTAAGT GCTCTTCGTG TTCCAAAACA TTCACGGACC TCGAAGCGGA CCAGCTGTTC 
0481 GACATGGCCA CGCTGGAGTT CC 
 Assemble Data

10415R-3.IR_full       1   ATGTCGTCGACATCGACGGCTGCAGCGAACGCAGCGCCAGCGAAAACGGAGGTGCGGTAC 60
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10415R-3.in silico     1   ATGTCGTCGACATCGACGGCTGCAGCGAACGCAGCGCCAGCGAAGACGGAGGTGCGGTAC 60


10415R-3.IR_full       61  GTGACCGAGGTGCCCAGCAGTCTGAANGCAACTGGCGCGCCTCGTGGTCCGTGGATTCTA 120
                           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
10415R-3.in silico     61  GTGACCGAGGTGCCCAGCAGTCTGAA-GCAACTGGCGCGCCTCGTGGTCCGTGGATTCTA 120


10415R-3.IR_full       121 TTCCCTGGAGGATGCGCTTATCATCGACATGCTGGTGCGGAATCCCTGCATGAAGGAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10415R-3.in silico     121 TTCCCTGGAGGATGCGCTTATCATCGACATGCTGGTGCGGAATCCCTGCATGAAGGAGGA 180


10415R-3.IR_full       181 CGACATCGGCGAGCTGTTGCGCTTTCGAGAAGAAGCAGTTAAGGGCCCGGATAACCACGC 240
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10415R-3.in silico     181 CGACATCGGCGAGCTGTTGCGC-TTCGAGAAGAAGCAGTTAAGGGCCCGGATAACCACGC 240


10415R-3.IR_full       241 TGCGCACCGACAAGTTCATCCAGATCAGGCTTAAAATGGAAACGGGGCCGGATGGTAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10415R-3.in silico     241 TGCGCACCGACAAGTTCATCCAGATCAGGCTTAAAATGGAAACGGGGCCGGATGGTAAGG 300


10415R-3.IR_full       301 CGCAGAAGGTCAATTACTACTTCATCAACTACAAGACCTTCGTGAACGTGGTGAAGTACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10415R-3.in silico     301 CGCAGAAGGTCAATTACTACTTCATCAACTACAAGACCTTCGTGAACGTGGTGAAGTACA 360


10415R-3.IR_full       361 AGCTGGATCTCATGCGCAAGCGTATGGNAGACGGAGGAGCGTGATGCCACCAGTAGAGCA 420
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10415R-3.in silico     361 AGCTGGATCTCATGCGCAAGCGTATGG-AGACGGAGGAGCGTGATGCCACCAGTAGAGCA 420


10415R-3.IR_full       421 AGTTTTAAGTGCTCTTCGTGTTCCAAAACATTCACGGACCTCGAAGCGGACCAGCTGTTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10415R-3.in silico     421 AGTTTTAAGTGCTCTTCGTGTTCCAAAACATTCACGGACCTCGAAGCGGACCAGCTGTTC 480


10415R-3.IR_full       481 GACATGGCCACGCTGGAGTTCC 502
                           ||||||||||||||||||||||
10415R-3.in silico     481 GACATGGCCACGCTGGAGTTCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_079302.2  CG10415-RA (TfIIEalpha), mRNA 
0.2   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0.2   NM_140915.3  CG14183-RA (CG14183), mRNA 
0   NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   NM_143262.1  CG14254-RA (CG14254), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_166590.1  CG30412-RB, transcript variant B (CG30412), mRNA 
0   NM_137933.2  CG30412-RA, transcript variant A (CG30412), mRNA 
0   NM_167543.1  CG32574-RA (CG32574), mRNA 
0   NM_141189.1  CG14640-RA (CG14640), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_167540.1  CG32570-RA (CG32570), mRNA 
0   NM_169299.1  CG9495-RA (Scm), mRNA 
0   NM_136059.2  CG10369-RA (Irk3), mRNA 
0   NM_205957.1  CG33304-RA (rho-5), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_140304.2  CG5620-RA, transcript variant A (CG5620), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_135134.2  CG9092-RA (Gal), mRNA 
0   16  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   16  NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_132987.1  CG5613-RA, transcript variant A (CG5613), mRNA 
0   NM_176750.1  CG5613-RB, transcript variant B (CG5613), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.