National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10392R-1 
 Symbol Ogt  Full Name O-glycosyltransferase 
 CG No CG10392  Old CG No CG10392 
 Synonyms CG10392, BcDNA:GH04245, Ogt 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees Lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACTGACTACGATATTCGC 
 Primer Seq. 3'
aatctagaggtaccTTCTTGCACCCTTTGTGTAGC 
 Predicted Fragment Size
505 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10392R-1.IR full       1   TGGACTGACTACGATATTCGCATGAAAAAACTGGTTAGCATTGTCACTGAGCAGCTTGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     1   TGGACTGACTACGATATTCGCATGAAAAAACTGGTTAGCATTGTCACTGAGCAGCTTGAA 60


10392R-1.IR full       61  AAAAACCGTTTACCATCCGTGCATCCACACCACTCGATGCTTTATCCGTTGACACATGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     61  AAAAACCGTTTACCATCCGTGCATCCACACCACTCGATGCTTTATCCGTTGACACATGAT 120


10392R-1.IR full       121 TGTCGGAAAGCAATTGCAGC-CGACACGCTAATTTGTGTTTAGAAAAAGTTCACGTGCTT 180
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     121 TGTCGGAAAGCAATTGCAGCGCGACACGCTAATTTGTGTTTAGAAAAAGTTCACGTGCTT 180


10392R-1.IR full       181 CATAAAAAACCTTATAATTTCTTAAAGAAGTTGCCTACAAAAGGAAGGCTTCGAATAGGT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     181 CATAAAAAACCTTATAATTTCTTAAAGAAGTTGCCTACAAAAGGAAGGCTTCGAATAGGT 240


10392R-1.IR full       241 TATCTTAGCTCGGACTTCGGGAATCATCCTACCTCGCATTTAATGCAATCTGTGCCAGGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     241 TATCTTAGCTCGGACTTCGGGAATCATCCTACCTCGCATTTAATGCAATCTGTGCCAGGT 300


10392R-1.IR full       301 CTTCATGATCGTTCAAAAGTGGAAATCTTTTGCTATGCCTTAAGTCCAGATGATGGTACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     301 CTTCATGATCGTTCAAAAGTGGAAATCTTTTGCTATGCCTTAAGTCCAGATGATGGTACA 360


10392R-1.IR full       361 ACATTTCGACACAAAATCAGTCGAGAGTCTGAAAACTTTGTGGATCTTTCTCAGATCCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     361 ACATTTCGACACAAAATCAGTCGAGAGTCTGAAAACTTTGTGGATCTTTCTCAGATCCCT 420


10392R-1.IR full       421 TGTAATGGCAAGGCAGCGGACAAGATATTTAATGACGGTATACATATTTTGGTTAATATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10392R-1.in silico     421 TGTAATGGCAAGGCAGCGGACAAGATATTTAATGACGGTATACATATTTTGGTTAATATG 480


10392R-1.IR full       481 AATGGCTACACAAAGGGTGCAAGAA 505
                           |||||||||||||||||||||||||
10392R-1.in silico     481 AATGGCTACACAAAGGGTGCAAGAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  487  NM_078896.2  O-glycosyltransferase CG10392-RB, transcript variant B (Ogt), mRNA 
100  487  NM_165426.1  O-glycosyltransferase CG10392-RA, transcript variant A (Ogt), mRNA 
100  487  NM_165427.1  O-glycosyltransferase CG10392-RC, transcript variant C (Ogt), mRNA 
NM_139371.1  CG13917-RA (CG13917), mRNA 
NM_001038777.1  CG33992-RA (CG33992), mRNA 
NM_001032256.1  Menl-1 CG7964-RB, transcript variant B (Menl-1), mRNA 
NM_001032255.1  Menl-1 CG7964-RC, transcript variant C (Menl-1), mRNA 
NM_001032257.1  Menl-1 CG7964-RA, transcript variant A (Menl-1), mRNA 
NM_001032253.1  CG7969-RB, transcript variant B (Menl-2), mRNA 
NM_206095.1  CG13214-RB, transcript variant B (CG13214), mRNA 
NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
NM_135011.2  CG15631-RA (CG15631), mRNA 
NM_142661.2  CG17273-RA (CG17273), mRNA 
NM_140331.2  CG10627-RA (CG10627), mRNA 
NM_140176.1  CG6279-RA (CG6279), mRNA 
NM_169022.1  Cdep CG31536-RA, transcript variant A (Cdep), mRNA 
NM_001043211.1  Cdep CG31536-RE, transcript variant E (Cdep), mRNA 
NM_169023.1  Cdep CG31536-RB, transcript variant B (Cdep), mRNA 
NM_176213.1  muscleblind CG33197-RC, transcript variant C (mbl), mRNA 
NM_135495.2  CG4778-RA (CG4778), mRNA 
NM_079985.2  bonus CG5206-RA (bon), mRNA 
NM_137093.4  CG30069-RA (CG30069), mRNA 
NM_080017.2  Smt3 activating enzyme 2 CG7528-RA (Uba2), mRNA 
NM_206353.1  dally-like CG32146-RB, transcript variant B (dlp), mRNA 
NM_079347.2  dally-like CG32146-RA, transcript variant A (dlp), mRNA 
NM_132750.2  CG9519-RA (CG9519), mRNA 
NM_134888.2  CG3165-RA (CG3165), mRNA 
NM_001015214.1  CG40160-PC.3 (CG40160), mRNA 
NM_169686.1  Synapse-associated protein 47kD CG8884-RD, transcript variant D (Sap47), mRNA 
NM_206184.1  bancal CG13425-RC, transcript variant C (bl), mRNA 
100  482  13  NM_078896.2  O-glycosyltransferase CG10392-RB, transcript variant B (Ogt), mRNA 
100  482  13  NM_165426.1  O-glycosyltransferase CG10392-RA, transcript variant A (Ogt), mRNA 
100  482  13  NM_165427.1  O-glycosyltransferase CG10392-RC, transcript variant C (Ogt), mRNA 
NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
10  NM_142597.2  Mediator complex subunit 25 CG12254-RA (MED25), mRNA 
11  NM_206681.2  discs large 1 CG1725-RH, transcript variant H (dlg1), mRNA 
11  NM_206683.2  discs large 1 CG1725-RB, transcript variant B (dlg1), mRNA 
NM_167282.2  discs large 1 CG1725-RA, transcript variant A (dlg1), mRNA 
NM_078565.3  discs large 1 CG1725-RD, transcript variant D (dlg1), mRNA 
NM_206682.2  discs large 1 CG1725-RG, transcript variant G (dlg1), mRNA 
NM_206684.2  discs large 1 CG1725-RE, transcript variant E (dlg1), mRNA 
11  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
11  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
15  NM_164981.1  CG18789-RA (CG18789), mRNA 
NM_167000.1  CG32778-RA (CG32778), mRNA 
NM_166296.1  CG30332-RA (CG30332), mRNA 
NM_176603.1  hephaestus CG31000-RH, transcript variant H (heph), mRNA 
NM_164985.1  Translocase of outer membrane 70 CG6756-RB, transcript variant B (Tom70), mRNA 
NM_135692.1  Translocase of outer membrane 70 CG6756-RA, transcript variant A (Tom70), mRNA 
NM_164986.1  Translocase of outer membrane 70 CG6756-RC, transcript variant C (Tom70), mRNA 
12  38  NM_132525.1  CG15740-RA (CG15740), mRNA 
17  NM_144407.2  CG18787-RA (CG18787), mRNA 
11  NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
10  NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
10  NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
10  NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
39  NM_167343.1  CG32642-RC (CG32642), mRNA 
12  NM_136910.1  CG13165-RA (CG13165), mRNA 
NM_132794.2  CG18210-RA (CG18210), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.