National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10379R-1 
 Symbol mbc  Full Name myoblast city 
 CG No CG10379  Old CG No CG10379 
 Synonyms Mbc, MBC, Crk/DOCK180, Su(rac)1, CG10379, mbc 
 Accession No (Link to NCBI) NM_057796.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGAGCGACTGCAATGCCAA 
 Primer Seq. 3'
aatctagaggtaccTGTCTCCGCTCTCGTCGCGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGAGCGAC TGCAATGCCA AGCAGGCAGA ATTCGGCATT GcCAAGTGCA ATTTCGACCA 
0061 GGAGTCGAAG CCACATCGCC TTAATCTGGA TGTGGGTGAT GCGGTCATAA TTCTTAAGGA 
0121 GACCACCCAT TGGTACTACG GCTACAGACA AAAAGCAAAG GAAATACGCG GCATATTTCC 
0181 CAAGAGCTAT ATACACTTAT GCGAATATAA TATCGTGAAT GGGGAGTACT GCATCCAGCG 
0241 CACGGATATT GTCGAGGAGA TCACTAAAGT TCTTCTCGAG TGGGGCTCCA TAGCCAAGGA 
0301 TTACTTTCTG ACCACAAATC CCAGCTTTCC CAAAATTCGA CGAAAAATGA ACGAATTAAA 
0361 TAATAATAGG GCGGCTTTGA TCTCCGGAAA CCTGCCATTG GACGAGNTGC gNAAGGTGAA 
0421 GCTGCTGGCC ACCAATCAGA TCGATACTGG CAACAAGCTC CTTGGCCTGG ACATGGTGGT 
0481 TCGCGACGAG AGCGGAGACA  
 in silico PCR Fragment
0001 GTGGAGCGAC TGCAATGCCA AGCAGGCAGA ATTCGGCATT GCCAAGTGCA ATTTCGACCA 
0061 GGAGTCGAAG CCACATCGCC TTAATCTGGA TGTGGGTGAT GCGGTCATAA TTCTTAAGGA 
0121 GACCACCCAT TGGTACTACG GCTACAGACA AAAAGCAAAG GAAATACGCG GCATATTTCC 
0181 CAAGAGCTAT ATACACTTAT GCGAATATAA TATCGTGAAT GGGGAGTACT GCATCCAGCG 
0241 CACGGATATT GTCGAGGAGA TCACTAAAGT TCTTCTCGAG TGGGGCTCCA TAGCCAAGGA 
0301 TTACTTTCTG ACCACAAATC CCAGCTTTCC CAAAATTCGA CGAAAAATGA ACGAATTAAA 
0361 TAATAATAGG GCGGCTTTGA TCTCCGGAAA CCTGCCATTG GACGAGGTGC GAAAGGTGAA 
0421 GCTGCTGGCC ACCAATCAGA TCGATACTGG CAACAAGCTC CTTGGCCTGG ACATGGTGGT 
0481 TCGCGACGAG AGCGGAGACA  
 Assemble Data

10379R-1.IR_full       1   GTGGAGCGACTGCAATGCCAAGCAGGCAGAATTCGGCATTGCCAAGTGCAATTTCGACCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     1   GTGGAGCGACTGCAATGCCAAGCAGGCAGAATTCGGCATTGCCAAGTGCAATTTCGACCA 60


10379R-1.IR_full       61  GGAGTCGAAGCCACATCGCCTTAATCTGGATGTGGGTGATGCGGTCATAATTCTTAAGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     61  GGAGTCGAAGCCACATCGCCTTAATCTGGATGTGGGTGATGCGGTCATAATTCTTAAGGA 120


10379R-1.IR_full       121 GACCACCCATTGGTACTACGGCTACAGACAAAAAGCAAAGGAAATACGCGGCATATTTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     121 GACCACCCATTGGTACTACGGCTACAGACAAAAAGCAAAGGAAATACGCGGCATATTTCC 180


10379R-1.IR_full       181 CAAGAGCTATATACACTTATGCGAATATAATATCGTGAATGGGGAGTACTGCATCCAGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     181 CAAGAGCTATATACACTTATGCGAATATAATATCGTGAATGGGGAGTACTGCATCCAGCG 240


10379R-1.IR_full       241 CACGGATATTGTCGAGGAGATCACTAAAGTTCTTCTCGAGTGGGGCTCCATAGCCAAGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     241 CACGGATATTGTCGAGGAGATCACTAAAGTTCTTCTCGAGTGGGGCTCCATAGCCAAGGA 300


10379R-1.IR_full       301 TTACTTTCTGACCACAAATCCCAGCTTTCCCAAAATTCGACGAAAAATGAACGAATTAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     301 TTACTTTCTGACCACAAATCCCAGCTTTCCCAAAATTCGACGAAAAATGAACGAATTAAA 360


10379R-1.IR_full       361 TAATAATAGGGCGGCTTTGATCTCCGGAAACCTGCCATTGGACGAGNTGCGNAAGGTGAA 420
                           |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||
10379R-1.in silico     361 TAATAATAGGGCGGCTTTGATCTCCGGAAACCTGCCATTGGACGAGGTGCGAAAGGTGAA 420


10379R-1.IR_full       421 GCTGCTGGCCACCAATCAGATCGATACTGGCAACAAGCTCCTTGGCCTGGACATGGTGGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10379R-1.in silico     421 GCTGCTGGCCACCAATCAGATCGATACTGGCAACAAGCTCCTTGGCCTGGACATGGTGGT 480


10379R-1.IR_full       481 TCGCGACGAGAGCGGAGACA 500
                           ||||||||||||||||||||
10379R-1.in silico     481 TCGCGACGAGAGCGGAGACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057796.2  CG10379-RA (mbc), mRNA 
0.2   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0.2   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0.2   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_141958.2  CG18616-RA (CG18616), mRNA 
0   NM_169298.1  CG8327-RA, transcript variant A (SpdS), mRNA 
0   NM_141664.2  CG8327-RB, transcript variant B (SpdS), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_142329.2  CG3590-RA (CG3590), mRNA 
0   NM_130589.1  CG14801-RB, transcript variant B (CG14801), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_170524.1  CG12072-RA (wts), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   NM_136432.1  CG11123-RA (CG11123), mRNA 
0   NM_165690.2  CG30005-RA (CG30005), mRNA 
0   NM_165171.2  CG17161-RB, transcript variant B (grp), mRNA 
0   NM_165172.2  CG17161-RC, transcript variant C (grp), mRNA 
0   NM_167359.1  CG1633-RB, transcript variant B (Jafrac1), mRNA 
0   NM_057663.3  CG17161-RA, transcript variant A (grp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.