National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10379R-1 
 Symbol mbc  Full Name myoblast city 
 CG No CG10379  Old CG No CG10379 
 Synonyms Mbc, MBC, Crk/DOCK180, Su(rac)1, CG10379, mbc 
 Accession No (Link to NCBI) NM_057796.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTGGAGCGACTGCAATGCCAAGCAGGCAGAATTCGGCATTGCCAAGTGCAATTTCGACCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAGTCGAAGCCACATCGCCTTAATCTGGATGTGGGTGATGCGGTCATAATTCTTAAGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACCACCCATTGGTACTACGGCTACAGACAAAAAGCAAAGGAAATACGCGGCATATTTCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAAGAGCTATATACACTTATGCGAATATAATATCGTGAATGGGGAGTACTGCATCCAGCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CACGGATATTGTCGAGGAGATCACTAAAGTTCTTCTCGAGTGGGGCTCCATAGCCAAGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTACTTTCTGACCACAAATCCCAGCTTTCCCAAAATTCGACGAAAAATGAACGAATTAAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| silico     361 TAATAATAGGGCGGCTTTGATCTCCGGAAACCTGCCATTGGACGAGGTGCGAAAGGTGAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCTGCTGGCCACCAATCAGATCGATACTGGCAACAAGCTCCTTGGCCTGGACATGGTGGT 480

10379R-1.IR_full       481 TCGCGACGAGAGCGGAGACA 500
                           |||||||||||||||||||| silico     481 TCGCGACGAGAGCGGAGACA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057796.2  CG10379-RA (mbc), mRNA 
0.2   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0.2   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0.2   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_141958.2  CG18616-RA (CG18616), mRNA 
0   NM_169298.1  CG8327-RA, transcript variant A (SpdS), mRNA 
0   NM_141664.2  CG8327-RB, transcript variant B (SpdS), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_142329.2  CG3590-RA (CG3590), mRNA 
0   NM_130589.1  CG14801-RB, transcript variant B (CG14801), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_170524.1  CG12072-RA (wts), mRNA 
0   NM_130671.2  CG2713-RA (CG2713), mRNA 
0   NM_136432.1  CG11123-RA (CG11123), mRNA 
0   NM_165690.2  CG30005-RA (CG30005), mRNA 
0   NM_165171.2  CG17161-RB, transcript variant B (grp), mRNA 
0   NM_165172.2  CG17161-RC, transcript variant C (grp), mRNA 
0   NM_167359.1  CG1633-RB, transcript variant B (Jafrac1), mRNA 
0   NM_057663.3  CG17161-RA, transcript variant A (grp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.