National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10367R-1 
 Symbol Hmgcr  Full Name HMG Coenzyme A reductase 
 CG No CG10367  Old CG No CG10367 
 Synonyms HMGCoAr, hmgcr, HMGCoARr, l(3)01152, clb, HMGCR_Dm, CG10367, DmHMG-CoAr, HMGCoAR, bs32f05.y1, HmG-CoAR, unnamed, Clb, Hmg, BcDNA:LD15354, Hmgcr, HMGCR, bro1 
 Accession No (Link to NCBI) NM_170089.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Belgacem YH, Martin JR.
Hmgcr in the corpus allatum controls sexual dimorphism of locomotor activity and body size via the insulin pathway in Drosophila.
PLoS ONE (2007) 2(1) e187 [ PubMed ID = 17264888 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATGCTCACGGTGGACAAGAA 
 Primer Seq. 3'
aatctagaggtaccCCGCTTGGTTACTGCCCGATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATGCTCACG GTGGACAAGA ACAATACCCT GGATGCGAGC AGCGGATTGG GCACAAGCCA 
0061 CCGCCTCAGC TGCCGCCGCC GGAGGATCCG GATCTGGAGC TGGATCTGGA GCAAGTGGAA 
0121 CAATACCACC ATCGTCTATG GGTGGCTCGG CCACCTCCAG CCGGCACAGG CCCTGTCACG 
0181 GTTGGAGCCA ATCCTGTGAT GGCCTAGAGG CCGAATACAA TGCAGCCGAC GTAATCCTGA 
0241 TGACCATCGT CCGCTGCACT GCCGTACTGT ACTGCTACTA CCAGTTCTGC AGCCTCCACC 
0301 GCCTGGGATC CAAATATGTG CTGGGCATTG CCGGCCTCTT CACGGTCTTC TCCAGCTTCA 
0361 TCTTCACGAC GGCCATCATC AAGTTCCTGG GCAGCGACAT CTCCGAACTG AAGGACGCCC 
0421 TGTTCTTCCT GCTGCTGGTC ATTGATCTGT CCAACTCTGG CCGCCTGGCG CaGCTGGCGC 
0481 TATCGGGCAG TAACCAAGCG G 
 in silico PCR Fragment
0001 CATGCTCACG GTGGACAAGA ACAATACCCT GGATGCGAGC AGCGGATTGG GCAC-AGCCA 
0061 CCGCCTCAGC TGCCGCCGCC GGAGGATCCG GATCTGGAGC TGGATCTGGA GCAAGTGGAA 
0121 CAATACCACC ATCGTCTATG GGTGGCTCGG CCACCTCCAG CCGGCACAGG CCCTGTCACG 
0181 GTTGGAGCCA ATCCTGTGAT GGCCTAGAGG CCGAATACAA TGCAGCCGAC GTAATCCTGA 
0241 TGACCATCGT CCGCTGCACT GCCGTACTGT ACTGCTACTA CCAGTTCTGC AGCCTCCACC 
0301 GCCTGGGATC CAAATATGTG CTGGGCATTG CCGGCCTCTT CACGGTCTTC TCCAGCTTCA 
0361 TCTTCACGAC GGCCATCATC AAGTTCCTGG GCAGCGACAT CTCCGAACTG AAGGACGCCC 
0421 TGTTCTTCCT GCTGCTGGTC ATTGATCTGT CCAACTCTGG CCGCCTGGCG CAGCTGGCGC 
0481 TATCGGGCAG TAACCAAGCG G 
 Assemble Data

10367R-1.IR_full       1   CATGCTCACGGTGGACAAGAACAATACCCTGGATGCGAGCAGCGGATTGGGCACAAGCCA 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10367R-1.in silico     1   CATGCTCACGGTGGACAAGAACAATACCCTGGATGCGAGCAGCGGATTGGGCAC-AGCCA 60


10367R-1.IR_full       61  CCGCCTCAGCTGCCGCCGCCGGAGGATCCGGATCTGGAGCTGGATCTGGAGCAAGTGGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     61  CCGCCTCAGCTGCCGCCGCCGGAGGATCCGGATCTGGAGCTGGATCTGGAGCAAGTGGAA 120


10367R-1.IR_full       121 CAATACCACCATCGTCTATGGGTGGCTCGGCCACCTCCAGCCGGCACAGGCCCTGTCACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     121 CAATACCACCATCGTCTATGGGTGGCTCGGCCACCTCCAGCCGGCACAGGCCCTGTCACG 180


10367R-1.IR_full       181 GTTGGAGCCAATCCTGTGATGGCCTAGAGGCCGAATACAATGCAGCCGACGTAATCCTGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     181 GTTGGAGCCAATCCTGTGATGGCCTAGAGGCCGAATACAATGCAGCCGACGTAATCCTGA 240


10367R-1.IR_full       241 TGACCATCGTCCGCTGCACTGCCGTACTGTACTGCTACTACCAGTTCTGCAGCCTCCACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     241 TGACCATCGTCCGCTGCACTGCCGTACTGTACTGCTACTACCAGTTCTGCAGCCTCCACC 300


10367R-1.IR_full       301 GCCTGGGATCCAAATATGTGCTGGGCATTGCCGGCCTCTTCACGGTCTTCTCCAGCTTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     301 GCCTGGGATCCAAATATGTGCTGGGCATTGCCGGCCTCTTCACGGTCTTCTCCAGCTTCA 360


10367R-1.IR_full       361 TCTTCACGACGGCCATCATCAAGTTCCTGGGCAGCGACATCTCCGAACTGAAGGACGCCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     361 TCTTCACGACGGCCATCATCAAGTTCCTGGGCAGCGACATCTCCGAACTGAAGGACGCCC 420


10367R-1.IR_full       421 TGTTCTTCCTGCTGCTGGTCATTGATCTGTCCAACTCTGGCCGCCTGGCGCAGCTGGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10367R-1.in silico     421 TGTTCTTCCTGCTGCTGGTCATTGATCTGTCCAACTCTGGCCGCCTGGCGCAGCTGGCGC 480


10367R-1.IR_full       481 TATCGGGCAGTAACCAAGCGG 501
                           |||||||||||||||||||||
10367R-1.in silico     481 TATCGGGCAGTAACCAAGCGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170089.1  CG10367-RA, transcript variant A (Hmgcr), mRNA 
100   482  NM_206548.1  CG10367-RB, transcript variant B (Hmgcr), mRNA 
0.82   NM_137995.2  CG18426-RA (ytr), mRNA 
0.41   NM_141572.1  CG11768-RA (CG11768), mRNA 
0.41   15  21  NM_206801.1  CG1391-RD, transcript variant D (sol), mRNA 
0.41   15  21  NM_057389.4  CG1391-RA, transcript variant A (sol), mRNA 
0.41   15  21  NM_206802.1  CG1391-RC, transcript variant C (sol), mRNA 
0.41   15  21  NM_057390.4  CG1391-RB, transcript variant B (sol), mRNA 
0   29  66  NM_131995.1  CG15784-RA (CG15784), mRNA 
0   19  35  NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   19  35  NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   11  NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   11  NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_137029.2  CG17034-RD, transcript variant D (CG17034), mRNA 
0   NM_165984.1  CG17034-RA, transcript variant A (CG17034), mRNA 
0   NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
0   NM_170625.1  CG17034-RC, transcript variant C (CG17034), mRNA 
0   NM_136517.2  CG8707-RA (CG8707), mRNA 
0   16  25  NM_132544.1  CG18130-RA (CG18130), mRNA 
0   13  35  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   13  18  NM_169953.1  CG3320-RA, transcript variant A (Rab1), mRNA 
0   13  18  NM_079708.4  CG3320-RB, transcript variant B (Rab1), mRNA 
0   11  28  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   11  28  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   NM_137965.2  CG10332-RA, transcript variant A (CG10332), mRNA 
0   NM_001032276.1  CG33706-RA, transcript variant A (IM18), mRNA 
0   NM_142080.1  CG9913-RA, transcript variant A (Kif19A), mRNA 
0   NM_206486.1  CG9913-RB, transcript variant B (Kif19A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.