National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1031R-1 
 Symbol alpha-Est1  Full Name alpha-Esterase-1 
 CG No CG1031  Old CG No CG1031 
 Synonyms CG1031, alphaE1, aE1, A, alpha-Est1 
 Accession No (Link to NCBI) NM_079545.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGTGGGCGATCTGCTGAAA 
 Primer Seq. 3'
aatctagaggtaccCCCAATGCGCCCACCCTATAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGTGGGCG ATCTGCTGAA AATGGGCACC AAGCTCATTG GCCACAAGAT CGTCCAGTAT 
0061 CGCCTTGGCA CAAAGCAGAC GAAGGTCGGT CTGCACCAGG GATGGCCAGG TGCGCGGACA 
0121 TCGCCGAAGG ACACTCTACG ACGAGGAGAT GTACTTCGCC TTCGAGGGAA TCCCCTTTGC 
0181 ACAGCCGCCG GTGGGGGAGC TGCGCTTCCG AGCCCCCCAG CCACCACATC CCTGGTTGGG 
0241 GGTGCGGGAT TGCACCTATC CGCGGGCCAA GCCGATGCAA AAGCACTTCG TGCTCAGCAT 
0301 CGTCGAAGGC AGCGAGGATT GCCTGTACCT GAACGTATAT TCCAAGCGCC TGAGATCGGA 
0361 CAAGCCGCTG CCCGTGATCG TGTGGATCTA TGGCGGTGGA TTCCAGTTCG GCGAGGCTGG 
0421 TCGAGATTTC TACAGTCCAG ACTACTTTAT GCAGCAAGAC GTAGTGGTTG TCACATTCAA 
0481 TTATAGGGTG GGCGCATTGG G 
 in silico PCR Fragment
0001 GGAGTGGGCG ATCTGCTGAA AATGGGCACC AAGCTCATTG GCCACAAGAT CGTCCAGTAT 
0061 CGCCTTGGCA CAAAGCAGAC GAAGGT-GGT CTGCACCAGG GATGGCCAGG TGCGCGGACA 
0121 TCGCCGAAGG ACACTCTACG ACGAGGAGAT GTACTTCGCC TTCGAGGGAA TCCCCTTTGC 
0181 ACAGCCGCCG GTGGGGGAGC TGCGCTTCCG AGCCCCCCAG CCACCACATC CCTGGTTGGG 
0241 GGTGCGGGAT TGCACCTATC CGCGGGCCAA GCCGATGCAA AAGCACTTCG TGCTCAGCAT 
0301 CGTCGAAGGC AGCGAGGATT GCCTGTACCT GAACGTATAT TCCAAGCGCC TGAGATCGGA 
0361 CAAGCCGCTG CCCGTGATCG TGTGGATCTA TGGCGGTGGA TTCCAGTTCG GCGAGGCTGG 
0421 TCGAGATTTC TACAGTCCAG ACTACTTTAT GCAGCAAGAC GTAGTGGTTG TCACATTCAA 
0481 TTATAGGGTG GGCGCATTGG G 
 Assemble Data

1031R-1.IR_full       1   GGAGTGGGCGATCTGCTGAAAATGGGCACCAAGCTCATTGGCCACAAGATCGTCCAGTAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     1   GGAGTGGGCGATCTGCTGAAAATGGGCACCAAGCTCATTGGCCACAAGATCGTCCAGTAT 60


1031R-1.IR_full       61  CGCCTTGGCACAAAGCAGACGAAGGTCGGTCTGCACCAGGGATGGCCAGGTGCGCGGACA 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
1031R-1.in silico     61  CGCCTTGGCACAAAGCAGACGAAGGT-GGTCTGCACCAGGGATGGCCAGGTGCGCGGACA 120


1031R-1.IR_full       121 TCGCCGAAGGACACTCTACGACGAGGAGATGTACTTCGCCTTCGAGGGAATCCCCTTTGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     121 TCGCCGAAGGACACTCTACGACGAGGAGATGTACTTCGCCTTCGAGGGAATCCCCTTTGC 180


1031R-1.IR_full       181 ACAGCCGCCGGTGGGGGAGCTGCGCTTCCGAGCCCCCCAGCCACCACATCCCTGGTTGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     181 ACAGCCGCCGGTGGGGGAGCTGCGCTTCCGAGCCCCCCAGCCACCACATCCCTGGTTGGG 240


1031R-1.IR_full       241 GGTGCGGGATTGCACCTATCCGCGGGCCAAGCCGATGCAAAAGCACTTCGTGCTCAGCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     241 GGTGCGGGATTGCACCTATCCGCGGGCCAAGCCGATGCAAAAGCACTTCGTGCTCAGCAT 300


1031R-1.IR_full       301 CGTCGAAGGCAGCGAGGATTGCCTGTACCTGAACGTATATTCCAAGCGCCTGAGATCGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     301 CGTCGAAGGCAGCGAGGATTGCCTGTACCTGAACGTATATTCCAAGCGCCTGAGATCGGA 360


1031R-1.IR_full       361 CAAGCCGCTGCCCGTGATCGTGTGGATCTATGGCGGTGGATTCCAGTTCGGCGAGGCTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     361 CAAGCCGCTGCCCGTGATCGTGTGGATCTATGGCGGTGGATTCCAGTTCGGCGAGGCTGG 420


1031R-1.IR_full       421 TCGAGATTTCTACAGTCCAGACTACTTTATGCAGCAAGACGTAGTGGTTGTCACATTCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1031R-1.in silico     421 TCGAGATTTCTACAGTCCAGACTACTTTATGCAGCAAGACGTAGTGGTTGTCACATTCAA 480


1031R-1.IR_full       481 TTATAGGGTGGGCGCATTGGG 501
                          |||||||||||||||||||||
1031R-1.in silico     481 TTATAGGGTGGGCGCATTGGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079545.2  CG1031-RA (alpha-Est1), mRNA 
1.03   19  23  NM_079535.2  CG1121-RA (alpha-Est8), mRNA 
0   10  24  27  NM_079534.1  CG1128-RB, transcript variant B (alpha-Est9), mRNA 
0   10  24  27  NM_169187.1  CG1128-RA, transcript variant A (alpha-Est9), mRNA 
0   13  22  NM_079538.2  CG1108-RA (alpha-Est6), mRNA 
0   11  NM_079542.2  CG1082-RA (alpha-Est4), mRNA 
0   NM_137125.2  CG12869-RA (CG12869), mRNA 
0   NM_057605.3  CG17907-RA (Ace), mRNA 
0   11  17  NM_079543.2  CG1257-RA (alpha-Est3), mRNA 
0   21  18  NM_079541.2  CG1089-RA (alpha-Est5), mRNA 
0   NM_142315.2  CG8977-RA, transcript variant A (Cctgamma), mRNA 
0   NM_169727.1  CG8977-RB, transcript variant B (Cctgamma), mRNA 
0   NM_137890.2  CG8977-RB, transcript variant B (Cctgamma), mRNA,5-epimerase/4-reductase CG3495-RA (Gmer), mRNA 
0   NM_164757.1  CG6772-RC, transcript variant C (Slob), mRNA 
0   NM_141400.2  CG10267-RA (CG10267), mRNA 
0   NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0   NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0   NM_140757.1  CG5577-RA (CG5577), mRNA 
0   NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_139973.1  CG6694-RA (CG6694), mRNA 
0   22  58  NM_137834.1  CG6018-RA (CG6018), mRNA 
0   21  51  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   13  40  NM_079544.3  CG2505-RA (alpha-Est2), mRNA 
0   11  11  NM_137241.1  CG8424-RA (Jhedup), mRNA 
0   10  10  NM_079537.2  CG1112-RA, transcript variant A (alpha-Est7), mRNA 
0   10  NM_169188.1  CG1112-RB, transcript variant B (alpha-Est7), mRNA 
0   NM_206671.1  CG9113-RE, transcript variant E (AP-1gamma), mRNA 
0   NM_132299.3  CG9113-RA, transcript variant A (AP-1gamma), mRNA 
0   NM_176718.1  CG9113-RD, transcript variant D (AP-1gamma), mRNA 
0   NM_167178.2  CG9113-RB, transcript variant B (AP-1gamma), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.