National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10289R-2 
 Symbol CG10289  Full Name CG10289 
 CG No CG10289  Old CG No CG10289 
 Synonyms CG10289 
 Accession No (Link to NCBI) NM_139776.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCACGACCGAGCCCTCTGAA 
 Primer Seq. 3'
aatctagaggtaccATGGGGTTGGATCCATCGAAG 
 Predicted Fragment Size
587 
 IR fragment full Seq
0001 ATCACGACCG AGCCCTCTGA AGATGTGCCC ATGTCGAAGC GTTTCCGCTA TGCCAACATG 
0061 TCCTGTGAGA TACTCACACT CGGCCTGCCG TCCCTGGATG AGAAGCTAAC TGAACGACGC 
0121 GGAGACGCTG CAGCCTGCTG TATTCATATC TGGAAAAGGA ACCACCGTTA AATCCATTGC 
0181 TATCGTCGTT TTTTAGCAAA ACGTTTAGCA TGCTCTTTAC CAAAAAGCCT GAACAAGATT 
0241 GGTTTTTGTA TCAACACATG TGCGCTACAA CTCCTGGAGT ATATTAAATC GCAGAAGACC 
0301 TTTTTGGATT TCATTTGTAA ACACTTTGAC ACACCGGTCA TACCTGATCT AATAATGCAG 
0361 ATGATGAAGG ACATCGAGGG TGGGCGACTT AAGCGGAACC TTTTCGAATG GCTAACTGAA 
0421 GATAAAATTG TTGAGAGACT GATTGCAATA TTGCGTAATC CTCAAGAAAC CGACAAACAT 
0481 GCAAATGTTG CCGACTTTTT CTGTGATCTT ATTAACCAAG GGCGTCTAAT GCGCCAGACC 
0541 GAGCAGGAGA ACGATTCGTT TGAGCCGGCC TTCGATGGAT CCAACCCCAT  
 in silico PCR Fragment
0001 ATCACGACCG AGCCCTCTGA AGATGTGCCC ATGTCGAAGC GTTTCCGCTA TGCCAACATG 
0061 TCCTGTGAGA TACTCACACT CGGCCTGCCG TCCCTGGATG AGAAGCT-AC TGAACGACGC 
0121 GGAGACGCTG CAG-CTGCTG TATTCATATC TGGAAAAGGA ACCACCGTTA AATCCATTGC 
0181 TATCGTCGTT TTTTAGCAAA ACGTTTAGCA TGCTCTTTAC CAAAAAGCCT GAACAAGATT 
0241 GGTTTTTGTA TCAACACATG TGC-CTACAA CTCCTGGAGT ATATTAAATC GCAGAAGACC 
0301 TTTTTGGATT TCATTTGTAA ACACTTTGAC ACACCGGTCA TACCTGATCT AATAATGCAG 
0361 ATGATGAAGG ACATCGAGGG TGGGCGACTT AAGCGGAACC TTTTCGAATG GCTAACTGAA 
0421 GATAAAATTG TTGAGAGACT GATTGCAATA TTGCGTAATC CTCAAGAAAC CGACAAACAT 
0481 GCAAATGTTG CCGACTTTTT CTGTGATCTT ATTAACCAAG GGCGTCTAAT GCGCCAGACC 
0541 GAGCAGGAGA ACGATTCGTT TGAGCCGGCC TTCGATGGAT CCAACCCCAT  
 Assemble Data

10289R-2.IR_full       1   ATCACGACCGAGCCCTCTGAAGATGTGCCCATGTCGAAGCGTTTCCGCTATGCCAACATG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     1   ATCACGACCGAGCCCTCTGAAGATGTGCCCATGTCGAAGCGTTTCCGCTATGCCAACATG 60


10289R-2.IR_full       61  TCCTGTGAGATACTCACACTCGGCCTGCCGTCCCTGGATGAGAAGCTAACTGAACGACGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10289R-2.in silico     61  TCCTGTGAGATACTCACACTCGGCCTGCCGTCCCTGGATGAGAAGCT-ACTGAACGACGC 120


10289R-2.IR_full       121 GGAGACGCTGCAGCCTGCTGTATTCATATCTGGAAAAGGAACCACCGTTAAATCCATTGC 180
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     121 GGAGACGCTGCAG-CTGCTGTATTCATATCTGGAAAAGGAACCACCGTTAAATCCATTGC 180


10289R-2.IR_full       181 TATCGTCGTTTTTTAGCAAAACGTTTAGCATGCTCTTTACCAAAAAGCCTGAACAAGATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     181 TATCGTCGTTTTTTAGCAAAACGTTTAGCATGCTCTTTACCAAAAAGCCTGAACAAGATT 240


10289R-2.IR_full       241 GGTTTTTGTATCAACACATGTGCGCTACAACTCCTGGAGTATATTAAATCGCAGAAGACC 300
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
10289R-2.in silico     241 GGTTTTTGTATCAACACATGTGC-CTACAACTCCTGGAGTATATTAAATCGCAGAAGACC 300


10289R-2.IR_full       301 TTTTTGGATTTCATTTGTAAACACTTTGACACACCGGTCATACCTGATCTAATAATGCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     301 TTTTTGGATTTCATTTGTAAACACTTTGACACACCGGTCATACCTGATCTAATAATGCAG 360


10289R-2.IR_full       361 ATGATGAAGGACATCGAGGGTGGGCGACTTAAGCGGAACCTTTTCGAATGGCTAACTGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     361 ATGATGAAGGACATCGAGGGTGGGCGACTTAAGCGGAACCTTTTCGAATGGCTAACTGAA 420


10289R-2.IR_full       421 GATAAAATTGTTGAGAGACTGATTGCAATATTGCGTAATCCTCAAGAAACCGACAAACAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     421 GATAAAATTGTTGAGAGACTGATTGCAATATTGCGTAATCCTCAAGAAACCGACAAACAT 480


10289R-2.IR_full       481 GCAAATGTTGCCGACTTTTTCTGTGATCTTATTAACCAAGGGCGTCTAATGCGCCAGACC 540
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     481 GCAAATGTTGCCGACTTTTTCTGTGATCTTATTAACCAAGGGCGTCTAATGCGCCAGACC 540


10289R-2.IR_full       541 GAGCAGGAGAACGATTCGTTTGAGCCGGCCTTCGATGGATCCAACCCCAT 590
                           ||||||||||||||||||||||||||||||||||||||||||||||||||
10289R-2.in silico     541 GAGCAGGAGAACGATTCGTTTGAGCCGGCCTTCGATGGATCCAACCCCAT 590

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   569  NM_139776.2  CG10289-RA (CG10289), mRNA 
0   NM_141762.2  CG14692-RA (CG14692), mRNA 
0   NM_139386.2  CG7974-RA (CG7974), mRNA 
0   NM_001038836.1  CG40174-RA (CG40174), mRNA 
0   12  21  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   NM_140489.2  CG6778-RA, transcript variant A (Aats-gly), mRNA 
0   NM_168605.1  CG6778-RB, transcript variant B (Aats-gly), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_167675.1  CG14213-RA, transcript variant A (CG14213), mRNA 
0   NM_134491.2  CG14213-RB, transcript variant B (CG14213), mRNA 
0   NM_166827.1  CG17743-RB, transcript variant B (pho), mRNA 
0   NM_079891.2  CG17743-RA, transcript variant A (pho), mRNA 
0   NM_166795.1  CG32021-RA (CG32021), mRNA 
0   10  NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_142201.1  CG14868-RA (CG14868), mRNA 
0   NM_135222.2  CG11188-RA (CG11188), mRNA 
0   NM_170264.1  CG6058-RD, transcript variant D (Ald), mRNA 
0   NM_170261.1  CG6058-RF, transcript variant F (Ald), mRNA 
0   NM_170263.1  CG6058-RC, transcript variant C (Ald), mRNA 
0   NM_170262.1  CG6058-RB, transcript variant B (Ald), mRNA 
0   NM_079528.2  CG2520-RA (lap), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_170009.2  CG31170-RB, transcript variant B (epsin-like), mRNA 
0   NM_170010.1  CG31170-RA, transcript variant A (epsin-like), mRNA 
0   10  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.