National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10279R-1 
 Symbol Rm62  Full Name Rm62 
 CG No CG10279  Old CG No CG10279 
 Synonyms CG10279, Dmp68, p68, Lip, RM62, DmRH8, 4136, l(3)s5196, l(3)rG338, l(3)j3D5, l(3)j3D2, l(3)01086, Rm62 
 Accession No (Link to NCBI) NM_079519.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Liaw GJ, Chiang CS.
Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.
Sci Rep (2019) 9(1) 1885 [ PubMed ID = 30760733 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGTGGTGGTGGATTCGGGGA 
 Primer Seq. 3'
aatctagaggtaccATTCGGTGGCCACCTGCTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGTGGTGGT GGATTCGGGG ATCGCCGAGG AGGAGGTGGC GGCGGCAGCC AAGACCTCCC 
0061 CATGCGTCCG GTCGACTTCT CCAACCTGGC TCCCTTCAAG AAGAACTTTT ACCAGGAGCA 
0121 CCCTAACGTA GCAAACCGAT CGCCCTACGA AGTTCAGAGG TATCGCGAAG AGCAGGAGAT 
0181 CACCGTGCGC GGACAGGTGC CGAACCCCAT CCAGGACTTC TCCGAGGTCC ATCTGCCCGA 
0241 CTACGTCATG AAGGAGATNC CGCCGACANG GCTNACAAGG CCCCCACCGC TATCCAAGCG 
0301 CAGGGCTGGC CTATCGCCAT GAGTGGCTCG AACTTCGTCG GCATTGCCAA GACGGGATCC 
0361 GGAAAGACCC TGGGCTACAT CCTGCCCGCT ATTGTCCACA TCAACAACCA GCAGCCGCTG 
0421 CAGAGGGGCG ACGGACCTAT CGCCCTCGTG CTGGCCCCCA CTCTGGGGAG CTGGCCCAAC 
0481 AGATCCAGCA GGTGGCCACC GAAT 
 in silico PCR Fragment
0001 AGGTGGTGGT GGATTCGGGG ATCGCCGAGG AGGAGGTGGC GGCGGCAGCC AAGACCTCCC 
0061 CATGCGTCCG GTCGACTTCT CCAACCTGGC TCCCTTCAAG AAGAACTTTT ACCAGGAGCA 
0121 CCCTAACGTA GCAAACCGAT CGCCCTACGA AGTTCAGAGG TATCGCGAAG AGCAGGAGAT 
0181 CACCGTGCGC GGACAGGTGC CGAACCCCAT CCAGGACTTC TCCGAGGTCC ATCTGCCCGA 
0241 CTACGTCATG AAGGAGAT-C CGCCGACAGG GCT-ACAAGG CCCCCACCGC TATCCAAGCG 
0301 CAGGGCTGGC CTATCGCCAT GAGTGGCTCG AACTTCGTCG GCATTGCCAA GACGGGATCC 
0361 GGAAAGACCC TGGGCTACAT CCTGCCCGCT ATTGTCCACA TCAACAACCA GCAGCCGCTG 
0421 CAGAGGGGCG ACGGACCTAT CGCCCTCGTG CTGGCCCCCA CTC--GGGAG CTGGCCCAAC 
0481 AGATCCAGCA GGTGGCCACC GAAT 
 Assemble Data

10279R-1.IR_full       1   AGGTGGTGGTGGATTCGGGGATCGCCGAGGAGGAGGTGGCGGCGGCAGCCAAGACCTCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     1   AGGTGGTGGTGGATTCGGGGATCGCCGAGGAGGAGGTGGCGGCGGCAGCCAAGACCTCCC 60


10279R-1.IR_full       61  CATGCGTCCGGTCGACTTCTCCAACCTGGCTCCCTTCAAGAAGAACTTTTACCAGGAGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     61  CATGCGTCCGGTCGACTTCTCCAACCTGGCTCCCTTCAAGAAGAACTTTTACCAGGAGCA 120


10279R-1.IR_full       121 CCCTAACGTAGCAAACCGATCGCCCTACGAAGTTCAGAGGTATCGCGAAGAGCAGGAGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     121 CCCTAACGTAGCAAACCGATCGCCCTACGAAGTTCAGAGGTATCGCGAAGAGCAGGAGAT 180


10279R-1.IR_full       181 CACCGTGCGCGGACAGGTGCCGAACCCCATCCAGGACTTCTCCGAGGTCCATCTGCCCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     181 CACCGTGCGCGGACAGGTGCCGAACCCCATCCAGGACTTCTCCGAGGTCCATCTGCCCGA 240


10279R-1.IR_full       241 CTACGTCATGAAGGAGATNCCGCCGACANGGCTNACAAGGCCCCCACCGCTATCCAAGCG 300
                           |||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||
10279R-1.in silico     241 CTACGTCATGAAGGAGAT-CCGCCGACAGGGCT-ACAAGGCCCCCACCGCTATCCAAGCG 300


10279R-1.IR_full       301 CAGGGCTGGCCTATCGCCATGAGTGGCTCGAACTTCGTCGGCATTGCCAAGACGGGATCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     301 CAGGGCTGGCCTATCGCCATGAGTGGCTCGAACTTCGTCGGCATTGCCAAGACGGGATCC 360


10279R-1.IR_full       361 GGAAAGACCCTGGGCTACATCCTGCCCGCTATTGTCCACATCAACAACCAGCAGCCGCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10279R-1.in silico     361 GGAAAGACCCTGGGCTACATCCTGCCCGCTATTGTCCACATCAACAACCAGCAGCCGCTG 420


10279R-1.IR_full       421 CAGAGGGGCGACGGACCTATCGCCCTCGTGCTGGCCCCCACTCTGGGGAGCTGGCCCAAC 480
                           |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
10279R-1.in silico     421 CAGAGGGGCGACGGACCTATCGCCCTCGTGCTGGCCCCCACTC--GGGAGCTGGCCCAAC 480


10279R-1.IR_full       481 AGATCCAGCAGGTGGCCACCGAAT 504
                           ||||||||||||||||||||||||
10279R-1.in silico     481 AGATCCAGCAGGTGGCCACCGAAT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  33  NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 
100   482  33  NM_169118.1  CG10279-RD, transcript variant D (Rm62), mRNA 
100   482  33  NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
100   482  33  NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
100   482  33  NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
100   482  33  NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0.82   NM_141334.1  CG10979-RA (CG10979), mRNA 
0.2   NM_143622.2  CG1800-RA (pasha), mRNA 
0   12  19  19  NM_132196.2  CG10777-RB (CG10777), mRNA 
0   11  52  NM_057695.3  CG4038-RA (CG4038), mRNA 
0   20  64  NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   20  64  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0   13  51  NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   16  NM_168379.1  CG32050-RA (CG32050), mRNA 
0   14  26  NM_167620.2  CG32547-RA (CG32547), mRNA 
0   10  15  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   10  15  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   NM_135952.1  CG5953-RA, transcript variant A (CG5953), mRNA 
0   NM_165165.1  CG5953-RB, transcript variant B (CG5953), mRNA 
0   10  12  NM_137995.2  CG18426-RA (ytr), mRNA 
0   25  NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
0   18  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   11  NM_168860.1  CG32425-RA, transcript variant A (CG32425), mRNA 
0   11  NM_168861.1  CG32425-RE, transcript variant E (CG32425), mRNA 
0   11  NM_168863.1  CG32425-RC, transcript variant C (CG32425), mRNA 
0   16  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
0   16  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
0   NM_130624.2  CG16903-RA (CG16903), mRNA 
0   13  NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0   13  NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.