National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10275R-1 
 Symbol perd  Full Name perdido 
 CG No CG10275  Old CG No CG10275 
 Synonyms CT28869, perd, CG10275 
 Accession No (Link to NCBI) NM_136037.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Weitkunat M, Kaya-Çopur A, Grill SW, Schnorrer F.
Tension and force-resistant attachment are essential for myofibrillogenesis in Drosophila flight muscle.
Curr. Biol. (2014) 24(7) 705-16 [ PubMed ID = 24631244 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCACTTCGGGACATTTCTGGGAGGCGTGGGGGACTTTACGGCCGAGTTCTTGGATGATGT 60

                           |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     61  TATCGGCTTTCGGGGCTGTATATCAGATGTCTTTTACAACAACATAAACATCATCAAACG 120

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCAAGGATCGCACGAGTCACACCACCAGTACTGGAGTTGCCTGGACTTGCAGCACTGA 180

                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| silico     181 GTTCGAAGGGTCCATTCAGGACAGCATTAGCTTCATGAGGAACGATTCGTATTCCTTGAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATGAAAGAATCGTATGCTATGGGAGAAACCCTTTCCTTGCAATTCCGCACAATGGCCAG 300

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     301 TGCTGGGGTTATTTTCTTCAACGGCGGCTATGATTTCATTCTCCTCGAAATAGAGGATCA 360

                            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     361 GCACTTGAAGGTGACCTTCAACAAGGCAGGCAGTCTGGTGCAGTTCATGACAAATGAGCA 420

                            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     421 CATATCCGATGGCAAATGGCATCGGGTCTTCTTGCGCTATAACGCCGCAATTGCGGAGCT 480

10275R-1.IR_full       481 AAGCCTCGACGATGCCACGA 500
                           |||||||||||||||||||| silico     481 AAGCCTCGACGATGCCACGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  NM_136037.2  CG10275-RA (CG10275), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   NM_206256.1  CG33233-RA, transcript variant A (CG33233), mRNA 
0   NM_137109.2  CG8613-RA (CG8613), mRNA 
0   NM_166583.1  CG3082-RB, transcript variant B (l(2)k09913), mRNA 
0   NM_137907.2  CG3082-RC, transcript variant C (l(2)k09913), mRNA 
0   NM_166582.1  CG3082-RA, transcript variant A (l(2)k09913), mRNA 
0   NM_166584.1  CG3082-RD, transcript variant D (l(2)k09913), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_165722.1  CG1429-RE, transcript variant E (Mef2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   10  NM_132559.1  CG2750-RA (CG2750), mRNA 
0   NM_165900.1  CG8830-RB, transcript variant B (CG8830), mRNA 
0   NM_136940.1  CG8830-RA, transcript variant A (CG8830), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_168440.2  CG32072-RA (CG32072), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_206658.1  CG11265-RE, transcript variant E (CG11265), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.