National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10275R-1 
 Symbol perd  Full Name perdido 
 CG No CG10275  Old CG No CG10275 
 Synonyms CT28869, perd, CG10275 
 Accession No (Link to NCBI) NM_136037.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Weitkunat M, Kaya-Çopur A, Grill SW, Schnorrer F.
Tension and force-resistant attachment are essential for myofibrillogenesis in Drosophila flight muscle.
Curr. Biol. (2014) 24(7) 705-16 [ PubMed ID = 24631244 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCACTTCGGGACATTTCTGGG 
 Primer Seq. 3'
aatctagaggtaccTCGTGGCATCGTCGAGGCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCACTTCGGG ACATTTCTGG GAGGCGTGGG GGACTTTACG GCCGAGTTCT TGGATGATGT 
0061 TATCGGTTTT CGGGGCTGTA TATCAGATGT CTTTTACAAC AACATCAACA TCATCAAACG 
0121 TGCCAAGGAT CGCACGAGTC ACACCACCAG TACTGGAGTT GCCTGGACTT GCAGCACTGA 
0181 GTTCGAAGGG TCCATTCAGG ACAGCATTAG TTTCATGAGG AACGATTCGT ATTCCCTGAT 
0241 GATGAAAGAA TCGTATGCTA TGGGAGAAAC CCTTTCCTTG CAATTCCGCA CAATGGCCAG 
0301 TGCTGGGGTT ATTTTCTTCA ACGGCGGCTT TGATTTCATT CTCCTCGAAA TAGAGGATCA 
0361 ACACTTGAAG GTGACCTTCA ACAAGGCCGG CAGTCTGGTG CAGTTCATGA CAAATGAGCA 
0421 TATATCCGAT GGCAAATGGC ATCGGGTCTT CTTGCGCTAT AACGCCGCCA TTGCGGAGCT 
0481 AAGCCTCGAC GATGCCACGA  
 in silico PCR Fragment
0001 CCACTTCGGG ACATTTCTGG GAGGCGTGGG GGACTTTACG GCCGAGTTCT TGGATGATGT 
0061 TATCGGCTTT CGGGGCTGTA TATCAGATGT CTTTTACAAC AACATAAACA TCATCAAACG 
0121 CGCCAAGGAT CGCACGAGTC ACACCACCAG TACTGGAGTT GCCTGGACTT GCAGCACTGA 
0181 GTTCGAAGGG TCCATTCAGG ACAGCATTAG CTTCATGAGG AACGATTCGT ATTCCTTGAT 
0241 GATGAAAGAA TCGTATGCTA TGGGAGAAAC CCTTTCCTTG CAATTCCGCA CAATGGCCAG 
0301 TGCTGGGGTT ATTTTCTTCA ACGGCGGCTA TGATTTCATT CTCCTCGAAA TAGAGGATCA 
0361 GCACTTGAAG GTGACCTTCA ACAAGGCAGG CAGTCTGGTG CAGTTCATGA CAAATGAGCA 
0421 CATATCCGAT GGCAAATGGC ATCGGGTCTT CTTGCGCTAT AACGCCGCAA TTGCGGAGCT 
0481 AAGCCTCGAC GATGCCACGA  
 Assemble Data

10275R-1.IR_full       1   CCACTTCGGGACATTTCTGGGAGGCGTGGGGGACTTTACGGCCGAGTTCTTGGATGATGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10275R-1.in silico     1   CCACTTCGGGACATTTCTGGGAGGCGTGGGGGACTTTACGGCCGAGTTCTTGGATGATGT 60


10275R-1.IR_full       61  TATCGGTTTTCGGGGCTGTATATCAGATGTCTTTTACAACAACATCAACATCATCAAACG 120
                           |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
10275R-1.in silico     61  TATCGGCTTTCGGGGCTGTATATCAGATGTCTTTTACAACAACATAAACATCATCAAACG 120


10275R-1.IR_full       121 TGCCAAGGATCGCACGAGTCACACCACCAGTACTGGAGTTGCCTGGACTTGCAGCACTGA 180
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10275R-1.in silico     121 CGCCAAGGATCGCACGAGTCACACCACCAGTACTGGAGTTGCCTGGACTTGCAGCACTGA 180


10275R-1.IR_full       181 GTTCGAAGGGTCCATTCAGGACAGCATTAGTTTCATGAGGAACGATTCGTATTCCCTGAT 240
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||
10275R-1.in silico     181 GTTCGAAGGGTCCATTCAGGACAGCATTAGCTTCATGAGGAACGATTCGTATTCCTTGAT 240


10275R-1.IR_full       241 GATGAAAGAATCGTATGCTATGGGAGAAACCCTTTCCTTGCAATTCCGCACAATGGCCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10275R-1.in silico     241 GATGAAAGAATCGTATGCTATGGGAGAAACCCTTTCCTTGCAATTCCGCACAATGGCCAG 300


10275R-1.IR_full       301 TGCTGGGGTTATTTTCTTCAACGGCGGCTTTGATTTCATTCTCCTCGAAATAGAGGATCA 360
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
10275R-1.in silico     301 TGCTGGGGTTATTTTCTTCAACGGCGGCTATGATTTCATTCTCCTCGAAATAGAGGATCA 360


10275R-1.IR_full       361 ACACTTGAAGGTGACCTTCAACAAGGCCGGCAGTCTGGTGCAGTTCATGACAAATGAGCA 420
                            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10275R-1.in silico     361 GCACTTGAAGGTGACCTTCAACAAGGCAGGCAGTCTGGTGCAGTTCATGACAAATGAGCA 420


10275R-1.IR_full       421 TATATCCGATGGCAAATGGCATCGGGTCTTCTTGCGCTATAACGCCGCCATTGCGGAGCT 480
                            ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
10275R-1.in silico     421 CATATCCGATGGCAAATGGCATCGGGTCTTCTTGCGCTATAACGCCGCAATTGCGGAGCT 480


10275R-1.IR_full       481 AAGCCTCGACGATGCCACGA 500
                           ||||||||||||||||||||
10275R-1.in silico     481 AAGCCTCGACGATGCCACGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  NM_136037.2  CG10275-RA (CG10275), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   NM_206256.1  CG33233-RA, transcript variant A (CG33233), mRNA 
0   NM_137109.2  CG8613-RA (CG8613), mRNA 
0   NM_166583.1  CG3082-RB, transcript variant B (l(2)k09913), mRNA 
0   NM_137907.2  CG3082-RC, transcript variant C (l(2)k09913), mRNA 
0   NM_166582.1  CG3082-RA, transcript variant A (l(2)k09913), mRNA 
0   NM_166584.1  CG3082-RD, transcript variant D (l(2)k09913), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_165722.1  CG1429-RE, transcript variant E (Mef2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   10  NM_132559.1  CG2750-RA (CG2750), mRNA 
0   NM_165900.1  CG8830-RB, transcript variant B (CG8830), mRNA 
0   NM_136940.1  CG8830-RA, transcript variant A (CG8830), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_168440.2  CG32072-RA (CG32072), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_206658.1  CG11265-RE, transcript variant E (CG11265), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+  
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.