National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10268R-2 
 Symbol CG10268  Full Name CG10268 
 CG No CG10268  Old CG No CG10268 
 Synonyms BcDNA:SD12705, CG10268 
 Accession No (Link to NCBI) NM_136148.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCATCAGCGGCAAGCGAAA 
 Primer Seq. 3'
aatctagaggtaccGTTCCTCGTCGTTGGCCAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCATCAGC GGCAAGCGAA AGTGCGGCAA GGATTACATA TCCGATAGGC TGCAGCGGAG 
0061 ATTGGGCTCC CGGTCGTGTA TCGTTCGAAT CTCAGAGCCC ATTAAGTCGG AATGGGCTCG 
0121 CCAAGCTGCA GTTGGACCTG GACGCTCTCC TCGGTGATGG ACCCTACAAG GAGAAGTACC 
0181 GGCGCGACAT GATTGTGTGG AGCGACGAGG TGCGGGCCCA GGACTACGGC TACTTCTGCC 
0241 GCGTGGCCAT GGAGGAGGCG CTGAGTCGCC AGCAGACGCC CTACATTCTG GTCAGCGATG 
0301 TGCGGCGCAA GAACGACATC AGGTGGTTCC GGGAGACTTA CGGGCCGGAA CGAGTCATCA 
0361 CCTTGCGTCT AACATCCCGT CCAGAAACGC GGTCTGCACG GGGATGGACC TTTACCGCAG 
0421 GAATAGACGA TGTTCCCTCC GAGTGCGATC TGGATGATCT GGCCGACGGC TTCGACGTGG 
0481 TGTTGGCCAA CGACGAGGAA C 
 in silico PCR Fragment
0001 ACTCATCAGC GGCAAGCGAA AGTGCGGCAA GGATTACATA TCCGAGAGGC TGCAGCGGAG 
0061 ATTGGGCTCC CGGTCGTGTA TCGTTCGAAT CTCAGAGCCC ATTAAGTCGG AATGGGCTCG 
0121 -CAAGCTGCA GTTGGACCTG GACGCTCTCC TCGGTGATGG ACCCTACAAG GAGAAGTACC 
0181 GGCGCGACAT GATTGTGTGG AGCGACGAGG TGCGGGCCCA GGACTACGGC TACTTCTGCC 
0241 GCGTGGCCAT GGAGGAGGCG CTGAGTCGCC AGCAGACGCC CTACATTCTG GTCAGCGATG 
0301 TGCGGCGCAA GAACGACATC AGGTGGTTCC GGGAGACTTA CGGGCCGGAA CGAGTCATCA 
0361 CCTTGCGTCT AACATCCCGT CCAGAAACGC GGTCTGCACG GGGATGGACC TTTACCGCAG 
0421 GAATAGACGA TGTTCCCTCC GAGTGCGATC TGGATGATCT GGCCGACGGC TTCGACGTGG 
0481 TGTTGGCCAA CGACGAGGAA C 
 Assemble Data

10268R-2.IR_full       1   ACTCATCAGCGGCAAGCGAAAGTGCGGCAAGGATTACATATCCGATAGGCTGCAGCGGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10268R-2.in silico     1   ACTCATCAGCGGCAAGCGAAAGTGCGGCAAGGATTACATATCCGAGAGGCTGCAGCGGAG 60


10268R-2.IR_full       61  ATTGGGCTCCCGGTCGTGTATCGTTCGAATCTCAGAGCCCATTAAGTCGGAATGGGCTCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     61  ATTGGGCTCCCGGTCGTGTATCGTTCGAATCTCAGAGCCCATTAAGTCGGAATGGGCTCG 120


10268R-2.IR_full       121 CCAAGCTGCAGTTGGACCTGGACGCTCTCCTCGGTGATGGACCCTACAAGGAGAAGTACC 180
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     121 -CAAGCTGCAGTTGGACCTGGACGCTCTCCTCGGTGATGGACCCTACAAGGAGAAGTACC 180


10268R-2.IR_full       181 GGCGCGACATGATTGTGTGGAGCGACGAGGTGCGGGCCCAGGACTACGGCTACTTCTGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     181 GGCGCGACATGATTGTGTGGAGCGACGAGGTGCGGGCCCAGGACTACGGCTACTTCTGCC 240


10268R-2.IR_full       241 GCGTGGCCATGGAGGAGGCGCTGAGTCGCCAGCAGACGCCCTACATTCTGGTCAGCGATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     241 GCGTGGCCATGGAGGAGGCGCTGAGTCGCCAGCAGACGCCCTACATTCTGGTCAGCGATG 300


10268R-2.IR_full       301 TGCGGCGCAAGAACGACATCAGGTGGTTCCGGGAGACTTACGGGCCGGAACGAGTCATCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     301 TGCGGCGCAAGAACGACATCAGGTGGTTCCGGGAGACTTACGGGCCGGAACGAGTCATCA 360


10268R-2.IR_full       361 CCTTGCGTCTAACATCCCGTCCAGAAACGCGGTCTGCACGGGGATGGACCTTTACCGCAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     361 CCTTGCGTCTAACATCCCGTCCAGAAACGCGGTCTGCACGGGGATGGACCTTTACCGCAG 420


10268R-2.IR_full       421 GAATAGACGATGTTCCCTCCGAGTGCGATCTGGATGATCTGGCCGACGGCTTCGACGTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10268R-2.in silico     421 GAATAGACGATGTTCCCTCCGAGTGCGATCTGGATGATCTGGCCGACGGCTTCGACGTGG 480


10268R-2.IR_full       481 TGTTGGCCAACGACGAGGAAC 501
                           |||||||||||||||||||||
10268R-2.in silico     481 TGTTGGCCAACGACGAGGAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136148.1  CG10268-RA (CG10268), mRNA 
0   NM_079260.1  CG4978-RA (Mcm7), mRNA 
0   NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
0   NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
0   NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
0   NM_001014641.1  CG7535-RC, transcript variant C (GluClalpha), mRNA 
0   NM_001038972.1  CG7535-RD, transcript variant D (GluClalpha), mRNA 
0   NM_169873.1  CG7535-RB, transcript variant B (GluClalpha), mRNA 
0   NM_142570.2  CG7535-RA, transcript variant A (GluClalpha), mRNA 
0   NM_142783.2  CG13849-RA (Nop56), mRNA 
0   NM_176202.1  CG4945-RB, transcript variant B (CG4945), mRNA 
0   NM_176203.1  CG4945-RC, transcript variant C (CG4945), mRNA 
0   NM_057378.2  CG4200-RA (sl), mRNA 
0   NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_057280.3  CG8695-RA (LvpL), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_206652.1  CG32717-RD, transcript variant D (sdt), mRNA 
0   NM_176469.1  CG3359-RL, transcript variant L (mfas), mRNA 
0   NM_079600.2  CG3359-RC, transcript variant C (mfas), mRNA 
0   NM_176474.1  CG3359-RO, transcript variant O (mfas), mRNA 
0   NM_176468.1  CG3359-RD, transcript variant D (mfas), mRNA 
0   NM_176475.1  CG3359-RF, transcript variant F (mfas), mRNA 
0   NM_176472.1  CG3359-RK, transcript variant K (mfas), mRNA 
0   NM_176470.1  CG3359-RP, transcript variant P (mfas), mRNA 
0   NM_176466.1  CG3359-RH, transcript variant H (mfas), mRNA 
0   NM_176477.1  CG3359-RM, transcript variant M (mfas), mRNA 
0   NM_176473.1  CG3359-RE, transcript variant E (mfas), mRNA 
0   NM_176471.1  CG3359-RI, transcript variant I (mfas), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.