National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10267R-2 
 Symbol CG10267  Full Name CG10267 
 CG No CG10267  Old CG No CG10267 
 Synonyms anon-WO0118547.391, CG10267 
 Accession No (Link to NCBI) NM_141400.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACAGCAATCTGAACGACAGAGAACACATACCCGATGGCATCTGCAAGTCCTGCAAGGTCG 60

                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     61  AACTCAACATGGCCTACCAGTTTCGCGAGAAGGCGCTGCGCA-AGCAGATGGAGATTGAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGTACTGCCGGGAACTGGGCTTGCTGGACGAATCAGATGTGATGATGATCAAGGAGGAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACGGCTCGCAGCAGCAATGCGACGAGGAGATGTACATCCTGGAGGAGACCACCACCGGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAAGAGGAGCACCAGGAAGAAAAGGGGCACGAGGAGTACTTGGAAGTGGACACCAGCGAT 300

                           ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     301 CAGCAGGAGTGCATTGGCG-ACACCATCGAGTACTTGGAGGACAACTACACCATCGAGAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAACTCCGATCAGACCGAGATCGTCCTGGAGTCTGAGAAGCAGTACGAAGAGACACCATC 420

                           |||||||||||||||||||||||||||||||||  |||||||  |||||||||||||||| silico     421 GCAGCAGTTGGCGCTGCAGGAGGCGGCCAAGGC--AAGCCTG--AAGGCGCGGCGCGGCC 480

                           |||||||||||||||||||||||||| silico     481 GGGTTCGTCGCGGATTAAACTCCCTA 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141400.2  CG10267-RA (CG10267), mRNA 
0   NM_141505.2  CG10903-RA (CG10903), mRNA 
0   NM_137392.1  CG6477-RA, transcript variant A (RhoGAP54D), mRNA 
0   NM_167421.1  CG32593-RD, transcript variant D (Flo-2), mRNA 
0   NM_167419.1  CG32593-RC, transcript variant C (Flo-2), mRNA 
0   NM_167417.1  CG32593-RF, transcript variant F (Flo-2), mRNA 
0   NM_167416.1  CG32593-RE, transcript variant E (Flo-2), mRNA 
0   NM_078602.2  CG32593-RB, transcript variant B (Flo-2), mRNA 
0   NM_167415.1  CG32593-RA, transcript variant A (Flo-2), mRNA 
0   NM_078727.2  CG4426-RA (ast), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_130729.2  CG2938-RB (CG2938), mRNA 
0   NM_141431.1  CG1105-RA (CG1105), mRNA 
0   NM_137016.3  CG17041-RA, transcript variant A (CG17041), mRNA 
0   NM_165978.1  CG17041-RC, transcript variant C (CG17041), mRNA 
0   NM_165977.1  CG17041-RB, transcript variant B (CG17041), mRNA 
0   NM_130524.2  CG3658-RA (CDC45L), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_079545.2  CG1031-RA (alpha-Est1), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   11  NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   11  NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.