National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10234R-2 
 Symbol Hs2st  Full Name Hs2st 
 CG No CG10234  Old CG No CG10234 
 Synonyms HS2ST, DmHs2st, dHS2ST, CG10234, Hs2st 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCTGATCCTGATAGCCCTG 
 Primer Seq. 3'
aatctagaggtaccCGGTAGTTGTCGCCAAAGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10234R-2.IR full       1   TGGCTGATCCTGATAGCCCTGTGCGCGGTCACCTGTGCAGGTTACTGGTTGCTTTGGTCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     1   TGGCTGATCCTGATAGCCCTGTGCGCGGTCACCTGTGCAGGTTACTGGTTGCTTTGGTCA 60


10234R-2.IR full       61  GAGATTCGCCTGGAACATGCCTTCAAGCCGCTTTCCAAGCTGGGCGATTCCCTGAGCCCA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
10234R-2.in silico     61  GAGATTCGCCTGGAACATGCCTTCAAGCCGCTTTCCAAGCTGGGCGATTCTCTGAGCCCA 120


10234R-2.IR full       121 GATCAGCATGCCTCGTCCACCACCGATGACTTTGACTTCGAGGAGCACCTGGTGGTGCTT 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
10234R-2.in silico     121 GATCAGCATGCCTCGTCCACCACCGATGACTTTGACTTCGAGGAGCACCTAGTGGTGCTT 180


10234R-2.IR full       181 TACAATCGCGTACCGAAAACGGGATCCACCAGCTTTGTTAACATAGCATACGATCTGTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     181 TACAATCGCGTACCGAAAACGGGATCCACCAGCTTTGTTAACATAGCATACGATCTGTGC 240


10234R-2.IR full       241 AAGCCCAATAAATTCCATGTGCTGCACATCAATGTCACTGCCAACATGCACGTCCTCTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     241 AAGCCCAATAAATTCCATGTGCTGCACATCAATGTCACTGCCAACATGCACGTCCTCTCG 300


10234R-2.IR full       301 CTTCCCAATCAAATCCAATTCGTGCGCAATGTTTCCAGGTGGCACGAGATGAAGCCAGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     301 CTTCCCAATCAAATCCAATTCGTGCGCAATGTTTCCAGGTGGCACGAGATGAAGCCAGCT 360


10234R-2.IR full       361 CTTTATCACGGCCACATGGCCTTCCTAGACTTCTCAAAATTCCAAATCGCCCACAAGCCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     361 CTTTATCACGGCCACATGGCCTTCCTAGACTTCTCAAAATTCCAAATCGCCCACAAGCCC 420


10234R-2.IR full       421 ATCTACATCAATTTGGTGCGCAAACCGCTCGACAGACTTGTCTCCTACTATTACTTTCTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10234R-2.in silico     421 ATCTACATCAATTTGGTGCGCAAACCGCTCGACAGACTTGTCTCCTACTATTACTTTCTA 480


10234R-2.IR full       481 CGCTTTGGCGACAACTACCG 500
                           ||||||||||||||||||||
10234R-2.in silico     481 CGCTTTGGCGACAACTACCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_057991.3  Hs2st CG10234-RA (Hs2st), mRNA 
NM_166670.1  CG30165-RA (CG30165), mRNA 
11  NM_176354.1  pipe CG9614-RG, transcript variant G (pip), mRNA 
NM_143000.1  CG17782-RA (CG17782), mRNA 
10  NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
10  NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
10  NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
10  NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
NM_141731.1  CG3996-RA (CG3996), mRNA 
NM_176099.1  CG33140-RA (CG33140), mRNA 
NM_132353.2  CG32698-RA (CG32698), mRNA 
NM_206657.1  Neuroglian CG1634-RC, transcript variant C (Nrg), mRNA 
NM_167160.1  Neuroglian CG1634-RB, transcript variant B (Nrg), mRNA 
NM_078535.2  Neuroglian CG1634-RA, transcript variant A (Nrg), mRNA 
NM_001043161.1  CG41457-RA (CG41457), mRNA 
NM_137951.1  CG5357-RA (CG5357), mRNA 
NM_166742.1  CG31998-RA (CG31998), mRNA 
NM_165203.1  CG31784-RA, transcript variant A (CG31784), mRNA 
NM_165204.1  CG31784-RB, transcript variant B (CG31784), mRNA 
NM_175941.1  CG11023-RA (CG11023), mRNA 
NM_132455.1  CG1961-RA (CG1961), mRNA 
NM_138091.2  CG3511-RA (CG3511), mRNA 
NM_079412.2  Wrinkled CG5123-RA (W), mRNA 
NM_169576.1  CG31321-RB (CG31321), mRNA 
NM_080512.2  Inverted repeat-binding protein CG5247-RA (Irbp), mRNA 
NM_141475.2  pyd3 CG3027-RA (pyd3), mRNA 
NM_143320.2  CG18437-RA (CG18437), mRNA 
NM_176359.1  pipe CG9614-RK, transcript variant K (pip), mRNA 
NM_135540.1  CG5022-RA (CG5022), mRNA 
NM_137999.2  CG5602-RA (CG5602), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.