National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10225R-4 
 Symbol CG10225  Full Name CG10225 
 CG No CG10225  Old CG No CG10225 
 Synonyms CG10225 
 Accession No (Link to NCBI) NM_142921.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGCGGCTCCAACAATAGT 
 Primer Seq. 3'
aatctagaggtaccCAAATGGATGAGGAGGCAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGCGGCT CCAACAATAG TTCCACATCC CCAAGTGCAG GTGAAGACAG CGCCCTGCTG 
0061 AATAATCCGT TTCTGCGCGA GTCCAAGGAC GACGACGATG ACGAGGAGGT GGTGGCCACC 
0121 GGATCTGCGG CAGCCGAGTC CACTGGCGAC AAGGAGGACG ACGATGTGGA CGAGCGGCCG 
0181 GATCCGCTGA CCAAGCTGCG TAGCAATGGC ATTGAGCGCT CCAGCATGTT TGCAGCAGCC 
0241 AAGAACAACA TGCCAAATGT TCAGTCCAGC GGGTTCGTCT TCGGCCAGAA TGTGCATGAA 
0301 CGTGTGGTGG CCCCCAATGC TGAACAGGTC ACCGCTGAGC CGGATGCAGA TACGGCAGCC 
0361 AGCTCGGTAT CAGCCCAGGA GGCTGCCTCC TCCTCCACCG CTGCTACGTC GTCCTCGGCG 
0421 CCATTGCTCT TCTCAAGCGT CATTCAGAAC GCTGCCCAGA CCACAGAGAC CAGCGAGGCC 
0481 GCTGCCTCCT CATCCATTTG  
 in silico PCR Fragment
0001 AGCAGCGGCT CCAACAATAG TTCCACATCC CCAAGTGCAG GTGAAGACAG CGCCCTGCTG 
0061 AATAATCCGT TTCTGCGCGA GTCCAAGGAC GACGACGATG ACGAGGAGGT GGTGGCCACC 
0121 GGATCTGCGG CAGCCGAGTC CACTGGCGAC AAGGAGGACG ACGATGTCGA CGAGCGGCCG 
0181 GATCCGCTGA CCAAGCTGCG TAGCAATGGC ATTGAGCGCT CCAGCATGTT TGCAGCAGCC 
0241 AAGAACAACA TGCCAAATGT TCAGTCCAGC GGGTTCGTCT TCGGCCAGAA TGTGCATGAA 
0301 CGTGTGGTGG CCCCCAATGC TGAACAGGTC ACCGCTGAGC CGGATGCAGA TACGGCAGCC 
0361 AGCTCGGTAT CAGCCCAGGA GGCTGCCTCC TCCTCCACCG CTGCTACGTC GTCCTCGGCG 
0421 CCATTGCTCT TCTCAAGCGT CATTCAGAAC GCTGCCCAGA CCACAGAGAC CAGCGAGGCC 
0481 GCTGCCTCCT CATCCATTTG  
 Assemble Data

10225R-4.IR_full       1   AGCAGCGGCTCCAACAATAGTTCCACATCCCCAAGTGCAGGTGAAGACAGCGCCCTGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     1   AGCAGCGGCTCCAACAATAGTTCCACATCCCCAAGTGCAGGTGAAGACAGCGCCCTGCTG 60


10225R-4.IR_full       61  AATAATCCGTTTCTGCGCGAGTCCAAGGACGACGACGATGACGAGGAGGTGGTGGCCACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     61  AATAATCCGTTTCTGCGCGAGTCCAAGGACGACGACGATGACGAGGAGGTGGTGGCCACC 120


10225R-4.IR_full       121 GGATCTGCGGCAGCCGAGTCCACTGGCGACAAGGAGGACGACGATGTGGACGAGCGGCCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10225R-4.in silico     121 GGATCTGCGGCAGCCGAGTCCACTGGCGACAAGGAGGACGACGATGTCGACGAGCGGCCG 180


10225R-4.IR_full       181 GATCCGCTGACCAAGCTGCGTAGCAATGGCATTGAGCGCTCCAGCATGTTTGCAGCAGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     181 GATCCGCTGACCAAGCTGCGTAGCAATGGCATTGAGCGCTCCAGCATGTTTGCAGCAGCC 240


10225R-4.IR_full       241 AAGAACAACATGCCAAATGTTCAGTCCAGCGGGTTCGTCTTCGGCCAGAATGTGCATGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     241 AAGAACAACATGCCAAATGTTCAGTCCAGCGGGTTCGTCTTCGGCCAGAATGTGCATGAA 300


10225R-4.IR_full       301 CGTGTGGTGGCCCCCAATGCTGAACAGGTCACCGCTGAGCCGGATGCAGATACGGCAGCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     301 CGTGTGGTGGCCCCCAATGCTGAACAGGTCACCGCTGAGCCGGATGCAGATACGGCAGCC 360


10225R-4.IR_full       361 AGCTCGGTATCAGCCCAGGAGGCTGCCTCCTCCTCCACCGCTGCTACGTCGTCCTCGGCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     361 AGCTCGGTATCAGCCCAGGAGGCTGCCTCCTCCTCCACCGCTGCTACGTCGTCCTCGGCG 420


10225R-4.IR_full       421 CCATTGCTCTTCTCAAGCGTCATTCAGAACGCTGCCCAGACCACAGAGACCAGCGAGGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10225R-4.in silico     421 CCATTGCTCTTCTCAAGCGTCATTCAGAACGCTGCCCAGACCACAGAGACCAGCGAGGCC 480


10225R-4.IR_full       481 GCTGCCTCCTCATCCATTTG 500
                           ||||||||||||||||||||
10225R-4.in silico     481 GCTGCCTCCTCATCCATTTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  31  NM_142921.2  CG10225-RA (CG10225), mRNA 
1.03   15  88  NM_132412.1  CG9817-RA (CG9817), mRNA 
0.82   15  NM_139854.1  CG8583-RA (sec63), mRNA 
0.82   13  NM_057589.2  CG3151-RA, transcript variant A (Rbp9), mRNA 
0.82   13  NM_057588.2  CG3151-RD, transcript variant D (Rbp9), mRNA 
0.82   13  NM_134297.3  CG3151-RB, transcript variant B (Rbp9), mRNA 
0.82   13  NM_134298.3  CG3151-RE, transcript variant E (Rbp9), mRNA 
0.82   13  NM_134299.3  CG3151-RF, transcript variant F (Rbp9), mRNA 
0.82   13  NM_134300.3  CG3151-RC, transcript variant C (Rbp9), mRNA 
0.82   13  NM_001014462.1  CG3151-RG, transcript variant G (Rbp9), mRNA 
0.82   NM_141152.1  CG6838-RA, transcript variant A (CG6838), mRNA 
0.82   NM_168955.1  CG6838-RB, transcript variant B (CG6838), mRNA 
0.41   NM_132126.1  CG3075-RA (CG3075), mRNA 
0.2   15  27  NM_167022.1  CG32771-RA (CG32771), mRNA 
0.2   10  17  NM_079289.2  CG10574-RA (I-2), mRNA 
0.2   12  NM_136033.2  CG12750-RA (ncm), mRNA 
0.2   30  NM_135755.1  CG9932-RA (CG9932), mRNA 
0   16  NM_134653.2  CG11454-RA (CG11454), mRNA 
0   13  40  NM_078601.2  CG9533-RA (rut), mRNA 
0   18  43  NM_131987.2  CG4202-RA (Sas10), mRNA 
0   16  18  NM_170161.1  CG31125-RA (CG31125), mRNA 
0   13  39  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0   13  37  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   13  37  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   13  37  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   13  20  NM_139540.1  CG14960-RA (CG14960), mRNA 
0   12  31  NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   11  24  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   10  32  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0   21  NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.