National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10210R-1 
 Symbol tst  Full Name twister 
 CG No CG10210  Old CG No CG10210 
 Synonyms SKI2, cg10210, Ski2, CG10210, tst, Ski2/tst 
 Accession No (Link to NCBI) NM_079741.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCGCAACTATATCCTGCGA 
 Primer Seq. 3'
aatctagaggtaccAGCTTCATCCACTCCTGGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCGCAACT ATATCCTGCG ACCGGAGCTG TCCCTCCACA ATCCCCTGCC GGATGTTTTG 
0061 CCCCGCAAAT TCGATCCGAT GCGCCTGTTG CATGCgCCCC GTTGCCCGGG AAGCACTAAG 
0121 TTGGCTCCTC GCCGCGACCA GAGTGGTCAC ATACTTGAGT TCGTGGAATT GGACTTGGAG 
0181 GCCGTGGGCG CCAATGCCAA CAACTCGATG TCCATGCAGC GGGAGCCGGG CTTGCTGGAA 
0241 GACGCGACGC GTGGCTCCCA CTCCAATTTT CCCTTTTGGC CAGGCGGTTT CGATGAGCAG 
0301 CGCCAGCAGA TCGCAGCTCT GGATGTCAGC AACTTTCAGT TCGGGGACAA GCTGCTAACG 
0361 GTGCCACCGG GCTTCAGCTC TGGCTACGAC TTCTTCCAAT CGCAATCTGT AACACTGCCG 
0421 CCTGTGGTCG CCGATCCCAG TAACGTTGAT CTATTGGAAA ACCTAGAACA GGATCTGGAC 
0481 GTCCAGGAGT GGATGAAGCT  
 in silico PCR Fragment
0001 CTGCGCAACT ATATCCTGCG ACCGGAGCTG TCCCTCCACA ATCCCCTGCC GGATGTTTTG 
0061 CCCCGCAAAT TCGATCCGAT GCGCCTGTTG CATGCGCCCC GTTGCCCGGG AAGCACTAAG 
0121 TTGGCTCCTC GCCGCGACCA GAGTGGTCAC ATACTTGAGT TCGTGGAATT GGACTTGGAG 
0181 GCCGTGGGCG CCAATGCCAA CAACTCGATG TCCATGCAGC GGGAGCCGGG CTTGCTGGAA 
0241 GACGCGACGC GTGGCTCCCA CTCCAATTTT CCCTTTTGGC CAGGCGGTTT CGATGAGCAG 
0301 CGCCAGCAGA TCGCAGCTCT GGATGTCAGC AACTTTCAGT TCGGGGACAA GCTGCTAACG 
0361 GTGCCACCGG GCTTCAGCTC TGGCTACGAC TTCTTCCAAT CGCAATCTGT AACACTGCCG 
0421 CCTGTGGTCG CCGATCCCAG TAACGTTGAT CTATTGGAAA ACCTAGAACA GGATCTGGAC 
0481 GTCCAGGAGT GGATGAAGCT  
 Assemble Data

10210R-1.IR_full       1   CTGCGCAACTATATCCTGCGACCGGAGCTGTCCCTCCACAATCCCCTGCCGGATGTTTTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     1   CTGCGCAACTATATCCTGCGACCGGAGCTGTCCCTCCACAATCCCCTGCCGGATGTTTTG 60


10210R-1.IR_full       61  CCCCGCAAATTCGATCCGATGCGCCTGTTGCATGCGCCCCGTTGCCCGGGAAGCACTAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     61  CCCCGCAAATTCGATCCGATGCGCCTGTTGCATGCGCCCCGTTGCCCGGGAAGCACTAAG 120


10210R-1.IR_full       121 TTGGCTCCTCGCCGCGACCAGAGTGGTCACATACTTGAGTTCGTGGAATTGGACTTGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     121 TTGGCTCCTCGCCGCGACCAGAGTGGTCACATACTTGAGTTCGTGGAATTGGACTTGGAG 180


10210R-1.IR_full       181 GCCGTGGGCGCCAATGCCAACAACTCGATGTCCATGCAGCGGGAGCCGGGCTTGCTGGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     181 GCCGTGGGCGCCAATGCCAACAACTCGATGTCCATGCAGCGGGAGCCGGGCTTGCTGGAA 240


10210R-1.IR_full       241 GACGCGACGCGTGGCTCCCACTCCAATTTTCCCTTTTGGCCAGGCGGTTTCGATGAGCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     241 GACGCGACGCGTGGCTCCCACTCCAATTTTCCCTTTTGGCCAGGCGGTTTCGATGAGCAG 300


10210R-1.IR_full       301 CGCCAGCAGATCGCAGCTCTGGATGTCAGCAACTTTCAGTTCGGGGACAAGCTGCTAACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     301 CGCCAGCAGATCGCAGCTCTGGATGTCAGCAACTTTCAGTTCGGGGACAAGCTGCTAACG 360


10210R-1.IR_full       361 GTGCCACCGGGCTTCAGCTCTGGCTACGACTTCTTCCAATCGCAATCTGTAACACTGCCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     361 GTGCCACCGGGCTTCAGCTCTGGCTACGACTTCTTCCAATCGCAATCTGTAACACTGCCG 420


10210R-1.IR_full       421 CCTGTGGTCGCCGATCCCAGTAACGTTGATCTATTGGAAAACCTAGAACAGGATCTGGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10210R-1.in silico     421 CCTGTGGTCGCCGATCCCAGTAACGTTGATCTATTGGAAAACCTAGAACAGGATCTGGAC 480


10210R-1.IR_full       481 GTCCAGGAGTGGATGAAGCT 500
                           ||||||||||||||||||||
10210R-1.in silico     481 GTCCAGGAGTGGATGAAGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079741.2  CG10210-RA (tst), mRNA 
0.2   NM_143435.2  CG2321-RA (CG2321), mRNA 
0.2   NM_135633.2  CG4636-RA (SCAR), mRNA 
0.2   NM_001042889.1  CG6105-RC, transcript variant C (l(2)06225), mRNA 
0   NM_142396.1  CG7397-RA (CG7397), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_141285.1  CG14670-RA (CG14670), mRNA 
0   NM_057462.3  CG1916-RA (Wnt2), mRNA 
0   17  NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_136827.2  CG7745-RA (CG7745), mRNA 
0   12  NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_166696.1  CG9071-RB, transcript variant B (NaCP60E), mRNA 
0   NM_079134.5  CG9071-RA, transcript variant A (NaCP60E), mRNA 
0   NM_138089.2  CG11416-RA (ori), mRNA 
0   NM_142644.1  CG5466-RA (CG5466), mRNA 
0   NM_206579.1  CG2005-RC, transcript variant C (Ptp99A), mRNA 
0   NM_170409.1  CG2005-RA, transcript variant A (Ptp99A), mRNA 
0   NM_001014683.1  CG2005-RD, transcript variant D (Ptp99A), mRNA 
0   NM_057468.2  CG2005-RB, transcript variant B (Ptp99A), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_167991.1  CG15812-RB, transcript variant B (pfk), mRNA 
0   NM_079173.4  CG15812-RA, transcript variant A (pfk), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_167275.1  CG32668-RA (CG32668), mRNA 
0   NM_132347.1  CG3099-RB (CG3099), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_136235.2  CG9270-RA, transcript variant A (CG9270), mRNA 
0   NM_206019.1  CG9270-RB, transcript variant B (CG9270), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.