National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1019R-3 
 Symbol Mlp84B  Full Name Muscle LIM protein at 84B 
 CG No CG1019  Old CG No CG1019 
 Synonyms mlp84B, dMlp84B, Mlmu84B, DmLIM-3, DLim-3, CG1019, Mlp84B 
 Accession No (Link to NCBI) NM_057774.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCAAGAAGGGTCTGGACT 
 Primer Seq. 3'
aatctagaggtaccCGTGGTGTCCGGGTTATAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCAAGAA GGGTCTGGAC TCGATCCTGT GCTGCGAgGC TCCGGACAAG AACATCTACT 
0061 GCAAGGGCTG CTATGCCAAG AAGTTTGGAC CCAAGGGCTA TGGTTATGGC CAGGGCGGTG 
0121 GTGCTCTCCA GTCCGACTGC TATGCTCACG ACGACGGAGC ACCGCAAATC CGTGCCGCCA 
0181 TTGATGTGGA CAAGATCCAG GCCCGTCCGG GTGAGGGTTG CCCACGTTGC GGCGGTGTNG 
0241 TCTACGCAGC GGAGcAGAAG CTTTCCAAGG GTCGGGAGTG GCACAAGAAG TGCTTCAACT 
0301 GCAAGGATTG CCACAAGACT CTGGACTCGA TCAATGCCAG TGATGGTCCC GATCGTGATG 
0361 TGTACTGCCG CACCTGCTAC GGCAAGAAGT NGGGGACCAC ATGGCTATGG ATCTCGCATG 
0421 CGGCTCTGGT TTCCTGCAGA CCGATGGCTT GACCGANGAT CAGATCAGCG cCAACAGGCC 
0481 CTTCTATAAC CCGGAACNCC ACg 
 in silico PCR Fragment
0001 CCTGCAAGAA GGGTCTGGAC TCGATCCTGT GCTGCGAGGC TCCGGACAAG AACATCTACT 
0061 GCAAGGGCTG CTATGCCAAG AAGTTTGGAC CCAAGGGCTA TGGTTATGGC CAGGGCGGTG 
0121 GTGCTCTCCA GTCCGACTGC TATGCTCACG ACGACGGAGC ACCGCAAATC CGTGCCGCCA 
0181 TTGATGTGGA CAAGATCCAG GCCCGTCCGG GTGAGGGTTG CCCACGTTGC GGCGGTGTGG 
0241 TCTACGCAGC GGAGCAGAAG CTTTCCAAGG GTCGGGAGTG GCACAAGAAG TGCTTCAACT 
0301 GCAAGGATTG CCACAAGACT CTGGACTCGA TCAATGCCAG TGATGGTCCC GATCGTGATG 
0361 TGTACTGCCG CACCTGCTAC GGCAAGAAGT -GGGGACCAC ATGGCTATGG AT-TCGCATG 
0421 CGGCTCTGGT TTCCTGCAGA CCGATGGCTT GACCGAGGAT CAGATCAGCG CCAACAGGCC 
0481 CTTCTATAAC CCGG-ACACC ACG 
 Assemble Data

1019R-3.IR_full       1   CCTGCAAGAAGGGTCTGGACTCGATCCTGTGCTGCGAGGCTCCGGACAAGAACATCTACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1019R-3.in silico     1   CCTGCAAGAAGGGTCTGGACTCGATCCTGTGCTGCGAGGCTCCGGACAAGAACATCTACT 60


1019R-3.IR_full       61  GCAAGGGCTGCTATGCCAAGAAGTTTGGACCCAAGGGCTATGGTTATGGCCAGGGCGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1019R-3.in silico     61  GCAAGGGCTGCTATGCCAAGAAGTTTGGACCCAAGGGCTATGGTTATGGCCAGGGCGGTG 120


1019R-3.IR_full       121 GTGCTCTCCAGTCCGACTGCTATGCTCACGACGACGGAGCACCGCAAATCCGTGCCGCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1019R-3.in silico     121 GTGCTCTCCAGTCCGACTGCTATGCTCACGACGACGGAGCACCGCAAATCCGTGCCGCCA 180


1019R-3.IR_full       181 TTGATGTGGACAAGATCCAGGCCCGTCCGGGTGAGGGTTGCCCACGTTGCGGCGGTGTNG 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
1019R-3.in silico     181 TTGATGTGGACAAGATCCAGGCCCGTCCGGGTGAGGGTTGCCCACGTTGCGGCGGTGTGG 240


1019R-3.IR_full       241 TCTACGCAGCGGAGCAGAAGCTTTCCAAGGGTCGGGAGTGGCACAAGAAGTGCTTCAACT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1019R-3.in silico     241 TCTACGCAGCGGAGCAGAAGCTTTCCAAGGGTCGGGAGTGGCACAAGAAGTGCTTCAACT 300


1019R-3.IR_full       301 GCAAGGATTGCCACAAGACTCTGGACTCGATCAATGCCAGTGATGGTCCCGATCGTGATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1019R-3.in silico     301 GCAAGGATTGCCACAAGACTCTGGACTCGATCAATGCCAGTGATGGTCCCGATCGTGATG 360


1019R-3.IR_full       361 TGTACTGCCGCACCTGCTACGGCAAGAAGTNGGGGACCACATGGCTATGGATCTCGCATG 420
                          |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||
1019R-3.in silico     361 TGTACTGCCGCACCTGCTACGGCAAGAAGT-GGGGACCACATGGCTATGGAT-TCGCATG 420


1019R-3.IR_full       421 CGGCTCTGGTTTCCTGCAGACCGATGGCTTGACCGANGATCAGATCAGCGCCAACAGGCC 480
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1019R-3.in silico     421 CGGCTCTGGTTTCCTGCAGACCGATGGCTTGACCGAGGATCAGATCAGCGCCAACAGGCC 480


1019R-3.IR_full       481 CTTCTATAACCCGGAACNCCACG 503
                          |||||||||||||| || |||||
1019R-3.in silico     481 CTTCTATAACCCGG-ACACCACG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  30  48  NM_057774.3  CG1019-RA, transcript variant A (Mlp84B), mRNA 
100   482  16  30  48  NM_169173.1  CG1019-RB, transcript variant B (Mlp84B), mRNA 
0   13  28  54  NM_166660.1  CG30174-RA (CG30174), mRNA 
0   NM_164887.1  CG31714-RA (CG31714), mRNA 
0   12  NM_166661.1  CG30179-RA (CG30179), mRNA 
0   NM_058026.3  CG5709-RA (ari-2), mRNA 
0   NM_206559.1  CG33341-RA (CG33341), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_168789.2  CG14084-RB, transcript variant B (CG14084), mRNA 
0   NM_140839.2  CG14084-RA, transcript variant A (CG14084), mRNA 
0   NM_144036.1  CG15458-RA (CG15458), mRNA 
0   NM_135838.2  CG7916-RA (CG7916), mRNA 
0   NM_137116.2  CG8422-RA (CG8422), mRNA 
0   NM_206309.1  CG4446-RB, transcript variant B (CG4446), mRNA 
0   NM_140044.1  CG4446-RA, transcript variant A (CG4446), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_140519.2  CG7739-RA (CG7739), mRNA 
0   NM_079948.2  CG10652-RA, transcript variant A (RpL30), mRNA 
0   NM_165271.1  CG10652-RB, transcript variant B (RpL30), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   12  NM_057252.3  CG3758-RA (esg), mRNA 
0   NM_140149.2  CG8003-RA (CG8003), mRNA 
0   30  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_137868.1  CG30268-RA (CG30268), mRNA 
0   NM_135186.1  CG16947-RA (CG16947), mRNA 
0   10  NM_206387.1  CG32171-RH, transcript variant H (Lmpt), mRNA 
0   10  NM_170635.1  CG32171-RD, transcript variant D (Lmpt), mRNA 
0   10  NM_206389.1  CG32171-RF, transcript variant F (Lmpt), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.