National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1019R-1 
 Symbol Mlp84B  Full Name Muscle LIM protein at 84B 
 CG No CG1019  Old CG No CG1019 
 Synonyms mlp84B, dMlp84B, Mlmu84B, DmLIM-3, DLim-3, CG1019, Mlp84B 
 Accession No (Link to NCBI) NM_057774.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCTGCAAGAAGGGTCTGGACTCGATCCTGTGCTGCGAGGCTCCGGACAAGAACATCTACT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAAGGGCTGCTATGCCAAGAAGTTTGGACCCAAGGGCTATGGTTATGGCCAGGGCGGTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTGCTCTCCAGTCCGACTGCTATGCTCACGACGACGGAGCACCGCAAATCCGTGCCGCCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     181 TTGATGTGGACAAGATCCAGGCCCGTCCGGGTGAGGGTTGCCCACGTTGCGGCGGTGTGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCTACGCAGCGGAGCAGAAGCTTTCCAAGGGTCGGGAGTGGCACAAGAAGTGCTTCAACT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCAAGGATTGCCACAAGACTCTGGACTCGATCAATGCCAGTGATGGTCCCGATCGTGATG 360

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| silico     361 TGTACTGCCGCACCTGCTACGGCAAGAAGT-GGGGACCACATGGCTATGGAT-TCGCATG 420

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     421 CGGCTCTGGTTTCCTGCAGACCGATGGCTTGACCGAGGATCAGATCAGCGCCAACAGGCC 480

1019R-1.IR_full       481 CTTCTATAACCCGGAACNCCACG 503
                          |||||||||||||| || ||||| silico     481 CTTCTATAACCCGG-ACACCACG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  30  48  NM_057774.3  CG1019-RA, transcript variant A (Mlp84B), mRNA 
100   482  16  30  48  NM_169173.1  CG1019-RB, transcript variant B (Mlp84B), mRNA 
0   13  28  54  NM_166660.1  CG30174-RA (CG30174), mRNA 
0   NM_164887.1  CG31714-RA (CG31714), mRNA 
0   12  NM_166661.1  CG30179-RA (CG30179), mRNA 
0   NM_058026.3  CG5709-RA (ari-2), mRNA 
0   NM_206559.1  CG33341-RA (CG33341), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_166941.1  CG32796-RA, transcript variant A (CG32796), mRNA 
0   NM_168789.2  CG14084-RB, transcript variant B (CG14084), mRNA 
0   NM_140839.2  CG14084-RA, transcript variant A (CG14084), mRNA 
0   NM_144036.1  CG15458-RA (CG15458), mRNA 
0   NM_135838.2  CG7916-RA (CG7916), mRNA 
0   NM_137116.2  CG8422-RA (CG8422), mRNA 
0   NM_206309.1  CG4446-RB, transcript variant B (CG4446), mRNA 
0   NM_140044.1  CG4446-RA, transcript variant A (CG4446), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_140519.2  CG7739-RA (CG7739), mRNA 
0   NM_079948.2  CG10652-RA, transcript variant A (RpL30), mRNA 
0   NM_165271.1  CG10652-RB, transcript variant B (RpL30), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   12  NM_057252.3  CG3758-RA (esg), mRNA 
0   NM_140149.2  CG8003-RA (CG8003), mRNA 
0   30  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_137868.1  CG30268-RA (CG30268), mRNA 
0   NM_135186.1  CG16947-RA (CG16947), mRNA 
0   10  NM_206387.1  CG32171-RH, transcript variant H (Lmpt), mRNA 
0   10  NM_170635.1  CG32171-RD, transcript variant D (Lmpt), mRNA 
0   10  NM_206389.1  CG32171-RF, transcript variant F (Lmpt), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.