National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10198R-1 
 Symbol Nup98  Full Name Nup98 
 CG No CG10198  Old CG No CG10198 
 Synonyms Nup96, Nup98-Nup96, CG10198, l(3)95BCd, Nup98/96, CG10201, Nup98 
 Accession No (Link to NCBI) NM_142930.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mondal BC, Shim J, Evans CJ, Banerjee U.
Pvr expression regulators in equilibrium signal control and maintenance of Drosophila blood progenitors.
Elife (2014) 3 e03626 [ PubMed ID = 25201876 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACCCAGCTTCGGAGCCACT 
 Primer Seq. 3'
aatctagaggtaccTTGGTGGTTGTAGGCGCCGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAACCCAGCT TCGGAGCCAC TCCGGCGGCC ACCAGCTTTG GCGGATTCAG CGGCACCACA 
0061 ACAACCACTC CGTTTGGCCA GTCGGCATTT GGCAAACCCG CCGCACCGGC CTTTGGAAAC 
0121 ACCTCCACCT TTGCCGCCCA ACCCGCGCAG CAGTCACTGT TCGGTGCGGC AGCCACACCA 
0181 GCTCAGCCCG CCGGAGGCTT ATTCGGGGCA AACACGTCCA CGGGATTTGG AAGCACTGCC 
0241 ACAGCTCAGC CCACGGCTTT TGGAGCCTTC TCGCAGCCGC AACAGACCTC GAACATATTT 
0301 GGATCCACCC AGACGGCGGC AAGCACCTCC CTCTTTGGAC AATCGACGCT ACCCGCCTTT 
0361 GGAGCCGCCA AGCCGACTAT GACGGCCTTT GGGCAAACAG CTGCTGCTCA GCCCACGGGC 
0421 TCTTTGTTTG GCCAACCGGC TGCCGCCACC AGTACAACAG GATTCGGAGG CTTTGGGACG 
0481 TCGGCGCCTA CAACCACCAA  
 in silico PCR Fragment
0001 AAACCCAGCT TCGGAGCCAC TCCGGCGGCC ACCAGCTTTG GCGGATTCAG CGGCACCACA 
0061 ACAACCACTC CGTTTGGCCA GTCGGCATTT GGCAAACCCG CCGCACCGGC CTTTGGAAAC 
0121 ACCTCCACCT TTGCCGCCCA ACCCGCGCAG CAGTCACTGT TCGGTGCGGC AGCCACACCA 
0181 GCTCAGCCCG CCGGAGGCTT ATTCGGGGCA AACACGTCCA CGGGATTTGG AAGCACTGCC 
0241 ACAGCTCAGC CCACGGCTTT TGGAGCCTTC TCGCAGCCGC AACAGACCTC GAACATATTT 
0301 GGATCCACCC AGACGGCGGC AAGCACCTCC CTCTTTGGAC AATCGACGCT ACCCGCCTTT 
0361 GGAGCCGCCA AGCCGACTAT GACGGCCTTT GGGCAAACAG CTGCTGCTCA GCCCACGGGC 
0421 TCTTTGTTTG GCCAACCGGC TGCCGCCACC AGTACAACAG GATTCGGAGG CTTTGGGACG 
0481 TCGGCGCCTA CAACCACCAA  
 Assemble Data

10198R-1.IR_full       1   AAACCCAGCTTCGGAGCCACTCCGGCGGCCACCAGCTTTGGCGGATTCAGCGGCACCACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     1   AAACCCAGCTTCGGAGCCACTCCGGCGGCCACCAGCTTTGGCGGATTCAGCGGCACCACA 60


10198R-1.IR_full       61  ACAACCACTCCGTTTGGCCAGTCGGCATTTGGCAAACCCGCCGCACCGGCCTTTGGAAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     61  ACAACCACTCCGTTTGGCCAGTCGGCATTTGGCAAACCCGCCGCACCGGCCTTTGGAAAC 120


10198R-1.IR_full       121 ACCTCCACCTTTGCCGCCCAACCCGCGCAGCAGTCACTGTTCGGTGCGGCAGCCACACCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     121 ACCTCCACCTTTGCCGCCCAACCCGCGCAGCAGTCACTGTTCGGTGCGGCAGCCACACCA 180


10198R-1.IR_full       181 GCTCAGCCCGCCGGAGGCTTATTCGGGGCAAACACGTCCACGGGATTTGGAAGCACTGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     181 GCTCAGCCCGCCGGAGGCTTATTCGGGGCAAACACGTCCACGGGATTTGGAAGCACTGCC 240


10198R-1.IR_full       241 ACAGCTCAGCCCACGGCTTTTGGAGCCTTCTCGCAGCCGCAACAGACCTCGAACATATTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     241 ACAGCTCAGCCCACGGCTTTTGGAGCCTTCTCGCAGCCGCAACAGACCTCGAACATATTT 300


10198R-1.IR_full       301 GGATCCACCCAGACGGCGGCAAGCACCTCCCTCTTTGGACAATCGACGCTACCCGCCTTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     301 GGATCCACCCAGACGGCGGCAAGCACCTCCCTCTTTGGACAATCGACGCTACCCGCCTTT 360


10198R-1.IR_full       361 GGAGCCGCCAAGCCGACTATGACGGCCTTTGGGCAAACAGCTGCTGCTCAGCCCACGGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     361 GGAGCCGCCAAGCCGACTATGACGGCCTTTGGGCAAACAGCTGCTGCTCAGCCCACGGGC 420


10198R-1.IR_full       421 TCTTTGTTTGGCCAACCGGCTGCCGCCACCAGTACAACAGGATTCGGAGGCTTTGGGACG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10198R-1.in silico     421 TCTTTGTTTGGCCAACCGGCTGCCGCCACCAGTACAACAGGATTCGGAGGCTTTGGGACG 480


10198R-1.IR_full       481 TCGGCGCCTACAACCACCAA 500
                           ||||||||||||||||||||
10198R-1.in silico     481 TCGGCGCCTACAACCACCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  23  NM_142930.2  CG10198-RA (Nup98), mRNA 
0   NM_079512.2  CG2899-RA (ksr), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_143048.1  CG11089-RA (CG11089), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0   NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_165608.1  CG30360-RA, transcript variant A (CG30360), mRNA 
0   NM_206057.1  CG30360-RB, transcript variant B (CG30360), mRNA 
0   NR_003116.1  CR41440, mRNA 
0   NM_142632.2  CG4288-RB, transcript variant B (CG4288), mRNA 
0   NM_169898.1  CG4288-RA, transcript variant A (CG4288), mRNA 
0   NM_167960.1  CG1244-RD, transcript variant D (CG1244), mRNA 
0   NM_167962.1  CG1244-RF, transcript variant F (CG1244), mRNA 
0   NM_167961.1  CG1244-RE, transcript variant E (CG1244), mRNA 
0   NM_167958.1  CG1244-RB, transcript variant B (CG1244), mRNA 
0   NM_139476.1  CG1244-RA, transcript variant A (CG1244), mRNA 
0   NM_167959.1  CG1244-RC, transcript variant C (CG1244), mRNA 
0   NM_140460.1  CG13473-RA (CG13473), mRNA 
0   NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 
0   NM_164313.1  CG12581-RB, transcript variant B (CG12581), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.