National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1017R-3 
 Symbol CG1017  Full Name CG1017 
 CG No CG1017  Old CG No CG1017 
 Synonyms CG1017 
 Accession No (Link to NCBI) NM_139422.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGACGACGATGACTTCATTG 
 Primer Seq. 3'
aatctagaggtaccCTCCTCGTACTCGGAGCTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGACGACGA TGACTTCATT GACACCAGGA AGCGCCTTGA GCgCCACAAG GCGGAACGGC 
0061 ATAAGCTGGA GCTCTCCCGT CANAGGCGGC AGCGCGGAGG GCGAAGAGCG GGCGGCGGGT 
0121 GAGGGCCAGG AGGAGGACGA TGCCGAGGTG GACGATCCAC GCCTCCGAAG ATTGCGGCAG 
0181 CGACCCGTAG ACATGGAGGA CATGGAACGT GAGCGGAGGG AACGCCACCG ACACATCCAC 
0241 GAACCGGAAA TCATGGAGAG TGACAGCGAA GACGAGGAGG AAGACGAGGG AGCACAGGGA 
0301 GCGATTCAGC GGGGCACCAA TAAGATCACA CTGGCATCCG AATCCGACAC GGATGCGGAG 
0361 CTCAGCGACA CAGAGCTGGA GAACCGGCGC ACCAAGCTGA GATNCCCGCA TGCTGCAGCA 
0421 GCAGCGCGAG GAGGAGGTTC TACAGAAAGA GGATGAGAAA CAGTCGGAAT CGTCCGAATC 
0481 AGAAAGCTCC GAGTACGAGG AG 
 in silico PCR Fragment
0001 GCGACGACGA TGACTTCATT GACACCAGGA AGCGCCTTGA GCGCCACAAG GCGGAACGGC 
0061 ATAAGCTGGA GCTCTCCCGT CA-AGGCGGC AGCGCGGAGG GCGAAGAGCG GGCGGCGGGT 
0121 GAGGGCCAGG AGGAGGACGA TGCCGAGGTG GACGATCCAC GCCTCCGAAG ATTGCGGCAG 
0181 CGACCCGTAG ACATGGAGGA CATGGAACGT GAGCGGAGGG AACGCCACCG ACACATCCAC 
0241 GAACCGGAAA TCATGGAGAG TGACAGCGAA GACGAGGAGG AAGACGAGGG AGCACAGGGA 
0301 GCGATTCAGC GGGGCACCAA TAAGATCACA CTGGCATCCG AATCCGACAC GGATGCGGAG 
0361 CTCAGCGACA CAGAGCTGGA GAACCGGCGC ACCAAGCTGA GAT-CCCGCA TGCTGCAGCA 
0421 GCAGCGCGAG GAGGAGGTTC TACAGAAAGA GGATGAGAAA CAGTCGGAAT CGTCCGAATC 
0481 AGAAAGCTCC GAGTACGAGG AG 
 Assemble Data

1017R-3.IR_full       1   GCGACGACGATGACTTCATTGACACCAGGAAGCGCCTTGAGCGCCACAAGGCGGAACGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     1   GCGACGACGATGACTTCATTGACACCAGGAAGCGCCTTGAGCGCCACAAGGCGGAACGGC 60


1017R-3.IR_full       61  ATAAGCTGGAGCTCTCCCGTCANAGGCGGCAGCGCGGAGGGCGAAGAGCGGGCGGCGGGT 120
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1017R-3.in silico     61  ATAAGCTGGAGCTCTCCCGTCA-AGGCGGCAGCGCGGAGGGCGAAGAGCGGGCGGCGGGT 120


1017R-3.IR_full       121 GAGGGCCAGGAGGAGGACGATGCCGAGGTGGACGATCCACGCCTCCGAAGATTGCGGCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     121 GAGGGCCAGGAGGAGGACGATGCCGAGGTGGACGATCCACGCCTCCGAAGATTGCGGCAG 180


1017R-3.IR_full       181 CGACCCGTAGACATGGAGGACATGGAACGTGAGCGGAGGGAACGCCACCGACACATCCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     181 CGACCCGTAGACATGGAGGACATGGAACGTGAGCGGAGGGAACGCCACCGACACATCCAC 240


1017R-3.IR_full       241 GAACCGGAAATCATGGAGAGTGACAGCGAAGACGAGGAGGAAGACGAGGGAGCACAGGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     241 GAACCGGAAATCATGGAGAGTGACAGCGAAGACGAGGAGGAAGACGAGGGAGCACAGGGA 300


1017R-3.IR_full       301 GCGATTCAGCGGGGCACCAATAAGATCACACTGGCATCCGAATCCGACACGGATGCGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     301 GCGATTCAGCGGGGCACCAATAAGATCACACTGGCATCCGAATCCGACACGGATGCGGAG 360


1017R-3.IR_full       361 CTCAGCGACACAGAGCTGGAGAACCGGCGCACCAAGCTGAGATNCCCGCATGCTGCAGCA 420
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
1017R-3.in silico     361 CTCAGCGACACAGAGCTGGAGAACCGGCGCACCAAGCTGAGAT-CCCGCATGCTGCAGCA 420


1017R-3.IR_full       421 GCAGCGCGAGGAGGAGGTTCTACAGAAAGAGGATGAGAAACAGTCGGAATCGTCCGAATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1017R-3.in silico     421 GCAGCGCGAGGAGGAGGTTCTACAGAAAGAGGATGAGAAACAGTCGGAATCGTCCGAATC 480


1017R-3.IR_full       481 AGAAAGCTCCGAGTACGAGGAG 502
                          ||||||||||||||||||||||
1017R-3.in silico     481 AGAAAGCTCCGAGTACGAGGAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139422.2  CG1017-RA (CG1017), mRNA 
0.2   12  NM_169947.1  CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
0.2   NM_164974.1  CG31758-RA (CG31758), mRNA 
0   12  NM_057364.3  CG9999-RA (RanGap), mRNA 
0   NM_134676.1  CG4213-RA (CG4213), mRNA 
0   NM_165907.3  CG12370-RA (CG12370), mRNA 
0   NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   15  NM_136854.1  CG13194-RA (pyr), mRNA 
0   25  NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   25  NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   25  NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   16  NM_143801.2  CG5935-RB, transcript variant B (Dek), mRNA 
0   16  NM_166198.1  CG5935-RC, transcript variant C (Dek), mRNA 
0   16  NM_206139.2  CG5935-RD, transcript variant D (Dek), mRNA 
0   16  NM_166199.2  CG5935-RA, transcript variant A (Dek), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NM_131943.2  CG11444-RA (CG11444), mRNA 
0   NM_140512.2  CG7857-RA (CG7857), mRNA 
0   16  10  NM_001015268.1  CG40450-PB.3 (CG40450), mRNA 
0   10  29  NM_140532.2  CG7372-RA (CG7372), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   26  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   18  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0   18  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0   NM_079930.2  CG3856-RB, transcript variant B (Oamb), mRNA 
0   14  NM_133011.2  CG8173-RA (CG8173), mRNA 
0   13  NM_135156.2  CG13991-RA (CG13991), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.